A novel mutation of δ‐aminolaevulinate dehydratase in a healthy child with 12% erythrocyte enzyme activity

Akagi, Reiko; Yasui, Yumiko; Harper, Pauline; Sassa, Shigeru

doi:10.1046/j.1365-2141.1999.01647.x

Cited by 23 publications

(27 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In addition, the laboratory features suggested a second enzyme deficiency, and the patient and his asymptomatic mother had abnormally decreased ALAD [E.C.4.2.1.24] activity. Molecular analysis showed that he carried both a novel mutation of the CPO gene ( CPOX ), as well as an F12L mutation of the ALAD gene ( ALAD ), which has been reported previously (Akagi et al , 1999). Thus, the patient was heterozygous at both the ALAD and CPO loci.…”

supporting

confidence: 59%

“…PCR amplification of the sequence encoding the mature portion of the CPO protein (reference sequence in gene bank ) was performed by using a set of oligomers, 5′‐CCACCGCCGCCTTCGGGCAT bound beginning at nucleotide 41 of the CPO sequence NM_000097, and 5′‐CCCCTGCACAGCCATTCTGCCT bound the complementary strand beginning at nucleotide 2317 (Martasek et al , 1994; Taketani et al , 1994). The entire coding region of ALAD cDNA was amplified by PCR, as described previously (Akagi et al , 1999). Amplifications were performed at least twice in separate experiments.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Dual gene defects involving δ‐aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient

et al. 2005

Self Cite

View full text Add to dashboard Cite

Summary A Caucasian male had symptoms of acute porphyria, with increases in urinary δ‐aminolaevulinic acid (ALA), porphobilinogen (PBG) and coproporphyrin that were consistent with hereditary coproporphyria (HCP). However, a greater than expected increase in ALA, compared with PBG, and a substantial increase in erythrocyte zinc protoporphyrin, suggested additional ALA dehydratase (ALAD) deficiency. Nucleotide sequence analysis of coproporphyrinogen oxidase (CPO) cDNA of the patient, but not of the parents, revealed a novel nucleotide transition G835→C, resulting in an amino acid change, G279R. The mutant CPO protein expressed in Escherichia coli was unstable, and produced about 5% of activity compared with the wild‐type CPO. Erythrocyte ALAD activity was 32% of normal in the proband. Nucleotide sequence analysis of cloned ALAD cDNAs from the patient revealed a C36→G base transition (F12L amino acid change). The F12L ALAD mutation, which was found in the mother and a brother, was previously described, and is known to lack any enzyme activity. This patient thus represents the first case of porphyria where both CPO and ALAD deficiencies were demonstrated at the molecular level.

show abstract

supporting

confidence: 59%

Section: Methodsmentioning

confidence: 99%

Dual gene defects involving δ‐aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient

et al. 2005

Self Cite

View full text Add to dashboard Cite

show abstract

“…11 The activity of mutant V153M ALAD and delTC were, however, 41% and 1.2% of the wild-type ALAD. Why the combination of V153M and delTC resulted in little enzyme activity in vivo in the patient is unclear, but it appears that delTC produces a dominant negative effect on the expression of ALAD in vivo in the patient.…”

Section: Discussionmentioning

confidence: 99%

“…Results with V153M and delTC, which had been identified in German patient B, also confirmed our findings on the phenotype of these proteins expressed in CHO cells. 11 The effect of heat treatment for 15 minutes prior to enzyme assay revealed that 3 mutants with significant ALAD activity had similar thermostability. These findings suggest that these mutant proteins have no overt structural abnormality, despite the fact that they have some reduced catalytic activity.…”

mentioning

confidence: 99%

Highly heterogeneous nature of δ-aminolevulinate dehydratase (ALAD) deficiencies in ALAD porphyria

Maruno

Furuyama

Akagi

et al. 2001

Blood

Self Cite

View full text Add to dashboard Cite

The properties of 9 ␦-aminolevulinate dehydratase (ALAD) mutants from patients with ALAD porphyria (ADP) were examined by bacterial expression of their complementary DNAs and by enzymologic and immunologic assays. ALADs were expressed as glutathione-S-transferase (GST) fusion proteins in Escherichia coli and purified by glutathioneaffinity column chromatography. The GST-ALAD fusion proteins were recognized by anti-ALAD antibodies and were enzymatically active as ALAD. The enzymatic activities of 3 ALAD mutants, K59N, A274T, and V153M, were 69.9%, 19.3%, and 41.0% of that of the wild-type ALAD, respectively, whereas 6 mutants, G133R, K59N/G133R, F12L, R240W, V275M, and delTC, showed little activity (< 8%). These variations generally reflect the phenotype of ALAD in vivo in patients with ADP and indicate that GST-ALAD fusion protein is indeed useful for predicting of the phenotype of ALAD mutants. The location of F12L mutation in the enzyme's molecular structure indicates that its disturbance of the quaternary contact of the ALAD dimer appears to have a significant influence on the enzymatic activity. Mouse monoclonal antibodies to human ALAD were developed that specifically recognized a carboxy terminal portion of ALAD, or other regions in the enzyme. This study represents the first complete analysis of 9 mutants of ALAD identified in ADP and indicates the highly heterogeneous nature of mutations in this disorder. IntroductionDelta-aminolevulinate dehydratase (ALAD) deficiency porphyria (ADP) is an autosomal recessive disorder caused by a homozygous ALAD deficiency. Patients with this condition have clinical symptoms of acute hepatic porphyria such as abdominal pain, vomiting, pain in the arms and legs, and neuropathy. ALAD is the second enzyme in the heme biosynthetic pathway. It catalyzes the Knorr-type condensation of 2 molecules of aminolevulinate acid (ALA) to form a monopyrrole, porphobilinogen (PBG). 1 This enzyme activity is present in large excess compared to other enzymes in the heme biosynthetic pathway, and its partial deficiency does not usually result in any clinical consequences. Seven patients with ADP have been reported to date, 2-6 though only 4 of them have been confirmed by immunochemical or molecular analysis. [2][3][4] Of these 4 cases, the first 2 were German patients reported by Doss and coworkers, 7 the third was a Swedish baby boy studied by Thunell and colleagues, 8 and the fourth was an elderly Belgian man reported by Hassoun and associates. 9 Recently, an asymptomatic Swedish baby girl has been identified to have a markedly decreased ALAD activity. 10 Thus far, a total of 9 point mutations of the alad gene have been identified in these 5 subjects, which resulted in different amino acid changes. However, the enzymatic activity of ALAD expressed by mutant ALAD was investigated only for 4 mutants, A274T and R240W, in German patient B, 3 and V153M and delTC in German patient H 11 (singleletter amino acid codes). This previous study with German patient B demonstrated that ALAD activity co...

show abstract

“…An asymptomatic child was discovered to have 12% PBGS activity and was heterozygous for genes encoding WT and F12L. 35 Phe12 is a phylogenetically variable residue, located in the middle of the N-terminal arm, whose backbone is within van der Waals contact of Cys223. A native Western blot published with the identification of F12L showed that the amino acid substitution limits the conformational space available to PBGS (Fig 9); however, identification of the alternate conformers was not addressed.…”

Section: Discovery Of the Pbgs Octamer Hexamer Equilibriummentioning

confidence: 99%

The Remarkable Character of Porphobilinogen Synthase

Jaffe

2016

Acc. Chem. Res.

View full text Add to dashboard Cite

Conspectus Porphobilinogen synthase (PBGS), also known as 5-aminolevulinate dehydratase, is an essential enzyme in the biosynthesis of all tetrapyrroles, which function in respiration, photosynthesis, and methanogenesis. Throughout evolution, PBGS adapted to a diversity of cellular niches and evolved to use an unusual variety of metal ions both for catalytic function and to control protein multimerization. With regard to the active site, some PBGS require Zn2+; a subset of those, including human PBGS, contain a constellation of cysteine residues that acts as a sink for the environmental toxin Pb2+. PBGS that do not require the soft metal ion Zn2+ at the active site, instead are suspected of using the hard metal, Mg2+. The most unexpected property of the PBGS family of enzymes is a dissociative allosteric mechanism that utilizes an equilibrium of architecturally and functionally distinct protein assemblies. The high-activity assembly is an octamer in which inter-subunit interactions modulate active-site lid motion. This octamer can dissociate to dimer, the dimer can undergo a hinge twist, and the twisted dimer can assemble to a low-activity hexamer. The hexamer does not have the intersubunit interactions required to stabilize a closed conformation of the active site lid. PBGS active site chemistry benefits from a closed lid because porphobilinogen biosynthesis includes Schiff base formation, which requires deprotonated lysine amino groups. N-terminal and C-terminal sequence extensions dictate whether or not a specific species of PBGS can sample the hexameric assembly. The bulk of species (nearly all except animals and yeasts) use Mg2+ as an allosteric activator. Mg2+ functions allosterically by binding to an intersubunit interface that is present in the octamer but absent in the hexamer. This conformational selection allosteric mechanism is purported to be essential to avoid the untimely accumulation of phototoxic chlorophyll precursors in plants. For those PBGS that do not use the allosteric Mg2+, there is a spatially equivalent arginine derived guanidium group. Deprotonation of this residue promotes formation of the hexamer and accounts for the basic arm of the bell-shaped pH vs. activity profile of human PBGS. A human inborn error of metabolism, known as ALAD porphyria, is attributed to PBGS variants that favor the hexameric assembly. The existence of one such variant, F12L, which dramatically stabilizes the human PBGS hexamer, allowed crystal structure determination for the hexamer. Without this crystal structure, and octameric PBGS structures containing the allosteric Mg2+, it would have been difficult to decipher the structural basis for PBGS allostery. The requirement for multimer dissociation as an intermediate step in PBGS allostery was established by monitoring subunit disproportionation during the turnover-dependent transition of heteromeric PBGS (comprised of human wild type and F12L) from hexamer to octamer. One outcome of these studies was the definition of the dissociative morpheein model of protei...

show abstract

A novel mutation of δ‐aminolaevulinate dehydratase in a healthy child with 12% erythrocyte enzyme activity

Cited by 23 publications

References 22 publications

Dual gene defects involving δ‐aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient

Dual gene defects involving δ‐aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient

Highly heterogeneous nature of δ-aminolevulinate dehydratase (ALAD) deficiencies in ALAD porphyria

The Remarkable Character of Porphobilinogen Synthase

Contact Info

Product

Resources

About