A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region

Abstract

Cephalopods are pivotal components of marine food webs, but biodiversity studies are hampered by challenges to sample these agile marine molluscs. Metabarcoding of environmental DNA (eDNA) is a potentially powerful technique to study oceanic cephalopod biodiversity and distribution but has not been applied thus far. We present a novel universal primer pair for metabarcoding cephalopods from eDNA, Ceph18S (Forward: 5′-CGC GGC GCT ACA TAT TAG AC-3′, Reverse: 5′-GCA CTT AAC CGA CCG TCG AC-3′). The primer pair targets the hypervariable region V2 of the nuclear 18S rRNA gene and amplifies a relatively short target sequence of approximately 200 bp in order to allow the amplification of degraded DNA. In silico tests on a reference database and empirical tests on DNA extracts from cephalopod tissue estimate that 44–66% of cephalopod species, corresponding to about 310–460 species, can be amplified and identified with this primer pair. A multi-marker approach with the novel Ceph18S and two previously published cephalopod mitochondrial 16S rRNA primer sets targeting the same region (Jarman et al . 2006 Mol. Ecol. Notes. 6 , 268–271; Peters et al . 2015 Mar. Ecol. 36 , 1428–1439) is estimated to amplify and identify 89% of all cephalopod species, of which an estimated 19% can only be identified by Ceph18S . All sequences obtained with Ceph18S were submitted to GenBank, resulting in new 18S rRNA sequences for 13 cephalopod taxa.

MetaBARFcoding: DNA‐barcoding of regurgitated prey yields insights into Christmas shearwater (Puffinus nativitatis) foraging ecology at Hōlanikū (Kure Atoll), Hawaiʻi

“…For example, since the initiation of our study, the Miya et al (2015) primer set has become widely adopted for fish metabarcoding, and will likely provide increased taxonomic coverage over the AM12s assay used here. Similarly, a recently published 18s primer set targeting Cephalopoda may also improve results over the COI assays used here (de Jonge et al, 2021). We encourage comparative primer set trials and use of multiple optimal primer sets in each metabarcoding study when possible.…”

Deep-Sea Predator-Prey Dynamics Revealed by Biologging and eDNA Analysis

“…We used one primer pair that targets the mitochondrial 16S rRNA gene (Jarman et al, 2006) and another that targets the nuclear 18S rRNA gene of cephalopods. The latter primer pair was developed by our lab (de Jonge et al, 2021).…”

Deep-sea predator niche segregation revealed by combined cetacean biologging and eDNA analysis of cephalopod prey

“…Two universal cephalopod primer sets were applied. The first primer set targeted the nuclear 18S rRNA gene yielding an amplicon of 140 to 190 base pairs (bp) (Ceph18S_forward CGCGGCGCTACATATT-AGAC and Ceph18S_reverse, GCACTTAACCGACCGTCGAC) (58). The second primer set targets the mitochondrial 16S rRNA gene yielding an amplicon of 212 to 244 bp [CephMLS_forward, TGCGGTAT-TWTAACTGTACT and CephMLS_reverse, TTATTCCTTRATCACCC (59)].…”

“…To complement public databases for the targeted mitochondrial 16S rRNA and nuclear 18S rRNA gene, additional cephalopod reference tissue samples, collected during WH383 on RV Walther Herwig III, were barcoded. For the nuclear 18S rRNA gene, the sequences barcoded in (58) were used. For Sanger sequencing of the mitochondrial 16S rRNA gene, the same DNA extracts were used as for the 18S rRNA gene, resulting in 33 successful cephalopod voucher sequences, including 32 different species and 15 different families.…”