A novel late embryogenesis abundant protein and peroxidase associated with black point in barley grains

Abstract

Black point of barley grain is a disorder characterised by a brown-black discolouration at the embryo end of the grain. Black point is undesirable to the malting industry and results in significant economic loss annually. To identify proteins associated with barley black point we utilised a proteomic approach with 2-DE to compare proteins from whole grain samples of black pointed and healthy grain. From this comparison two condition-specific proteins were identified: a novel 75 kDa late embryogenesis abundant (LEA) protein and a barley grain peroxidase 1 (BP1) that were specifically more abundant in healthy grain and black pointed grain, respectively. Although LEA protein was less abundant in black pointed grain, LEA gene expression was greater suggesting protein degradation had possibly occurred in black pointed grain. Similarly, the increase in BP1 in black pointed grain could not be explained by gene expression. Western blot analysis also revealed that the identified LEA protein is biotinylated in vivo. The role that each of these proteins might have in black point development is discussed.

Identification of genetic regions associated with black point in barley

“…A number of proteins have been associated with BP, including a novel 75-kDa late embryogenesis protein, which was more abundant in healthy grain and a barley grain peroxidase 1 protein, which was more abundant in black pointed grain. Higher levels of protein associated with stress, disease and defence have also been observed in BP-free grain in wheat, suggesting that protection from BP may be due to increased levels of these proteins (Mak et al, 2006;March et al, 2007).…”

A Novel Late Embryogenesis Abundant Like Protein Associated with Chilling Stress in Nicotiana tabacum cv. Bright Yellow-2 Cell Suspension Culture

“…The cDNA was synthesized using oligo (dT) 18 primer (GACTCTAGACGACATCGA(T) 15 ) and ReverTra Ace M-MLV RTase (TaKaRa, Dalian, China) according to the manufacture recommendation.…”

“…For the 3Ј-RACE, specific primers (GCTAACTCTTCCACTTGAGAA and GACTCTAGACGACATCGA(T) 18 ) were designed. For 5Ј-RACE, the first strand cDNA synthesized was further tailed poly (C) at the 3Ј-end with terminal deoxynucleotidyl transferase according to the manufacturer instructions, and the poly (C)-tailed cDNA was used as template and nested PCR was performed.…”

“…LEA proteins were first identified and characterized in cotton (12), and are highly synthesized during in the later stages of embryogenesis in higher plants. There are many LEA proteins and their genes or cDNAs have been described in different plant species (13)(14)(15)(16)(17)(18), and most of the proteins share common features such as high hydrophilicity, biased amino acid composition, and the predicted random coil structures (19). In addition to being accumulated in the embryo, some LEA proteins can also be induced in vegetative tissues by some environmental stress (20).…”

A Review: Biological and Technological Functions of Barley Seed Pathogenesis-Related Proteins (PRs)

“…Infection by F. culmorum caused an increase in peroxidase activity from the early stages of development of inoculated wheat seedlings 47 . An increase in BP1 in black pointed barley grain, undesirable to the malting industry, has been observed using proteomics 206 . Relationships between peroxidase activity and salt tolerance during barley germination 211 , as well as with acid rain stress response during germination of rice and wheat 356 , were recently established.…”