A Novel Dual- cre Motif Enables Two-Way Autoregulation of CcpA in Clostridium acetobutylicum

Abstract

The master regulator CcpA (catabolite control protein A) manages a large and complex regulatory network that is essential for cellular physiology and metabolism in Gram-positive bacteria. Although CcpA can affect the expression of target genes by binding to a -acting catabolite-responsive element (), whether and how the expression of CcpA is regulated remain poorly explored. Here, we report a novel dual- motif that is employed by the CcpA in , a typical solventogenic species, for autoregulation. Two sites are involved in CcpA autoregulation, and they reside in the promoter and coding regions of CcpA. In this dual- motif, , in the promoter region, positively regulates transcription, whereas , in the coding region, negatively regulates this transcription, thus enabling two-way autoregulation of CcpA. Although CcpA bound more strongly than , the assay showed that -based repression dominates CcpA autoregulation during the entire fermentation. Finally, a synonymous mutation of was made within the coding region, achieving an increased intracellular CcpA expression and improved cellular performance. This study provides new insights into the regulatory role of CcpA in and, moreover, contributes a new engineering strategy for this industrial strain. CcpA is known to be a key transcription factor in Gram-positive bacteria. However, it is still unclear whether and how the intracellular CcpA level is regulated, which may be essential for maintaining normal cell physiology and metabolism. We discovered here that CcpA employs a dual- motif to autoregulate, enabling dynamic control of its own expression level during the entire fermentation process. This finding answers the questions above and fills a void in our understanding of the regulatory network of CcpA. Interference in CcpA autoregulation leads to improved cellular performance, providing a new useful strategy in genetic engineering of Since CcpA is widespread in Gram-positive bacteria, including pathogens, this dual--based CcpA autoregulation would be valuable for increasing our understanding of CcpA-based global regulation in bacteria.

Interactive Regulation of Formate Dehydrogenase during CO 2 Fixation in Gas-Fermenting Bacteria

“…The importance of CcpA in regulating carbon metabolism has also been reported in the saccharolytic Clostridium species (15). Nevertheless, whether and how the in vivo level of CcpA is regulated in Gram-positive bacteria remain poorly understood to date, despite the elucidation of a transcriptional autoregulation mechanism for this important TF (38). Therefore, the findings in this study reveal a new regulatory mechanism that controls CcpA function in bacterial cells.…”

“…cDNA was obtained by reverse transcription using a PrimeScript RT reagent kit (TaKaRa). The procedure of real-time qPCR (qRT-PCR) was the same as described previously (38). The primers used for qRT-PCR are listed in Table S3.…”

Metabolic Reprogramming of Clostridioides difficile During the Stationary Phase With the Induction of Toxin Production

“…Moreover, the regulatory principles of CcpA from Clostridia differ from those of Bacilli ( Yang et al, 2017 ). Very recently some autoregulation of the ccpA gene from C. acetobutylicum was observed ( Zhang et al, 2018 ). However, the observed degree of regulation did not suggest major concentration changes of the protein in the cell.…”

A new CcpA binding site plays a bidirectional role in carbon catabolism in Bacillus licheniformis

“…Researchers generally agreed that CRE sites were highly degenerated pseudo-palindromes and that the lack of stringent sequence conservation provides CcpA with a high degree of regulatory flexibility. Examples include “RRGAAAANGTTTTCWW” in Clostridium difficile ( Antunes et al., 2012 ), TGTTATATAACA in Clostridium acetobutylicum ( Willenborg et al., 2014 ), four CcpA binding sites (GAAGTTTTAAG; ATTTTTTGT; TATGAAAAATTTTAAAAAGTGGA; AGGCTTATCATAG) in Streptococcus mutans ( Kim and Burne, 2017 ), and “TTTTYHWDHHWWTTTY” (Y represents base C or T, H represents base A, C, or T, W represents base A or T, and D represents base A, G, or T) in Streptococcus suis ( Zhang et al., 2018 ). However, more differentiated CRE patterns are needed to explain how CcpA can bind such a diverse set of operator sites.…”