A novel cloning strategy for one-step assembly of multiplex CRISPR vectors

Zuckermann, Marc; Hlevnjak, Mario; Yazdanparast, Haniyeh; Zapatka, Marc; Jones, David; Lichter, Peter; Gronych, Jan

doi:10.1038/s41598-018-35727-3

Cited by 29 publications

(25 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…EdU labeling reaction was conducted as described in (Zeng et al 2010 (Zuckermann et al 2018). For Ptch1 only targeting construct, the sgRNA for Bcor was replaced with a control sgRNA (GCGACCAATACGCGAACGTC).…”

Section: Edu Injections and Imagingmentioning

confidence: 99%

Functional loss of a non-canonical BCOR-PRC1.1 complex accelerates SHH-driven medulloblastoma formation

Kutscher

Okonechnikov

Batora

et al. 2020

Preprint

View full text Add to dashboard Cite

Medulloblastoma is a childhood brain tumor arising from the developing cerebellum. In Sonic Hedgehog (SHH)-subgroup medulloblastoma, aberrant activation of SHH signaling causes increased proliferation of granule neuron progenitors (GNPs) and predisposes these cells to tumorigenesis. A second, cooperating genetic hit is often required to push these hyperplastic cells to malignancy and confer mutation-specific characteristics associated with oncogenic signaling. Somatic loss-of-function mutations of the transcriptional co-repressor BCOR are recurrent and highly enriched in SHH-medulloblastoma. To investigate BCOR as a putative tumor suppressor, we used a germline genetically engineered mouse model to delete exons 9/10 of Bcor (BcorΔE9-10) in GNPs during development. This leads to reduced expression of C-terminally truncated BCOR (BCORΔE9-10). While BcorΔE9-10 alone did not promote tumorigenesis or affect GNP differentiation, BcorΔE9-10 combined with loss of the SHH-receptor gene Ptch1 resulted in highly penetrant medulloblastomas. In Ptch1+/-;BcorΔE9-10 tumors, the growth factor gene Igf2 was aberrantly upregulated, and ectopic Igf2 overexpression was sufficient to drive tumorigenesis in Ptch1+/- GNPs. BCOR directly regulates Igf2, likely through the PRC1.1 complex; the repressive histone mark H2AK119Ub is decreased at the Igf2 promoter in Ptch1+/-;BcorΔE9-10 tumors. Overall, our data suggests that BCOR-PRC1.1 disruption leads to Igf2 overexpression, which transforms preneoplastic cells to malignant tumors.

show abstract

Section: Edu Injections and Imagingmentioning

confidence: 99%

Functional loss of a non-canonical BCOR-PRC1.1 complex accelerates SHH-driven medulloblastoma formation

Kutscher

Okonechnikov

Batora

et al. 2020

Preprint

View full text Add to dashboard Cite

show abstract

“…The Golden Gate cloning system has used to develop a multiplex CRISPR vectors for various downstream applications. This method was called ASAP-cloning (Adaptable System for Assembly of multiplexed Plasmid) (Zuckermann et al, 2018). The TrichoGate system can be modified for CRISPR applications by the integration of a self-replication fragment in the recipient plasmid; additionally, this plasmid can contain the U6 promoter, the gRNA scaffold and the terminator, although these components can be part of different entry vectors.…”

Section: Generation Of Time-effective Knockout and Complementation Mumentioning

confidence: 99%

TrichoGate: An Improved Vector System for a Large Scale of Functional Analysis of Trichoderma Genes

et al. 2019

View full text Add to dashboard Cite

Species of the genus Trichoderma are ubiquitous in the environment and are widely used in agriculture, as biopesticides, and in the industry for the production of plant cell wall-degrading enzymes. Trichoderma represents an important genus of endophytes, and several Trichoderma species have become excellent models for the study of fungal biology and plant-microbe interactions; moreover, are exceptional biotechnological factories for the production of bioactive molecules useful in agriculture and medicine. Next-generation sequencing technology coupled with systematic construction of recombinant DNA molecules provides powerful tools that contribute to the functional analysis of Trichoderma genetics, thus allowing for a better understanding of the underlying factors determining its biology. Here, we present the creation of diverse vectors containing (i) promoter-specific vectors for Trichoderma, (ii) gene deletions (using hygromycin phosphotransferase as selection marker), (iii) protein localization (mCherry and eGFP, which were codon-optimized for Trichoderma), (iv) gene complementation (neomycin phosphotransferase) and (v) overexpression of encoding gene proteins fused to fluorescent markers, by using the Golden Gate cloning technology. Furthermore, we present the design and implementation of a binary vector for Agrobacterium-mediated transformation in Trichoderma to increase the homologous recombination rate and the generation of a novel selection marker based on carboxin resistance.

show abstract

“…By simply changing the ~ 20-nt sequence, we can quickly and easily build a tool to edit a specific gene in animals and plants. In addition, the expression of several gRNAs with SpCas9 proteins in a single cell can simultaneously edits several genes or induce the large deletion of the specific chromosome [5][6][7][8][9][10][11][12][13]. However, the mutation efficiency of each SpCas9-gRNA complex varies considerably, depending on the gRNA-binding loci.…”

Section: Introductionmentioning

confidence: 99%

A multiplex guide RNA expression system and its efficacy for plant genome engineering

Lee

Kim

et al. 2020

Plant Methods

View full text Add to dashboard Cite

Background: The Streptococcus pyogenes CRISPR system is composed of a Cas9 endonuclease (SpCas9) and a singlestranded guide RNA (gRNA) harboring a target-specific sequence. Theoretically, SpCas9 proteins could cleave as many targeted loci as gRNAs bind in a genome. Results: We introduce a PCR-free multiple gRNA cloning system for editing plant genomes. This method consists of two steps: (1) cloning the annealed products of two single-stranded oligonucleotide fragments harboring a complimentary target-binding sequence on each strand between tRNA and gRNA scaffold sequences in a pGRNA vector; and (2) assembling tRNA-gRNA units from several pGRNA vectors with a plant binary vector containing a SpCas9 expression cassette using the Golden Gate assembly method. We validated the editing efficiency and patterns of the multiplex gRNA expression system in wild tobacco (Nicotiana attenuata) protoplasts and in transformed plants by performing targeted deep sequencing. Two proximal cleavages by SpCas9-gRNA largely increased the editing efficiency and induced large deletions between two cleavage sites. Conclusions: This multiplex gRNA expression system enables high-throughput production of a single binary vector and increases the efficiency of plant genome editing.

show abstract

A novel cloning strategy for one-step assembly of multiplex CRISPR vectors

Cited by 29 publications

References 20 publications

Functional loss of a non-canonical BCOR-PRC1.1 complex accelerates SHH-driven medulloblastoma formation

Functional loss of a non-canonical BCOR-PRC1.1 complex accelerates SHH-driven medulloblastoma formation

TrichoGate: An Improved Vector System for a Large Scale of Functional Analysis of Trichoderma Genes

A multiplex guide RNA expression system and its efficacy for plant genome engineering

Contact Info

Product

Resources

About