A Novel Chimeric Mitochondrial RNA Localized in the Nucleus of Mouse Sperm

Villegas, Jaime; Zárraga, Ana María; Müller, Ilse; Montecinos, Luis; Werner, E; Brito, Mónica; Meneses, Ana María; Burzio, Luis O.

doi:10.1089/104454900439809

Cited by 32 publications

(35 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Total RNA from cells and isolated mitochondria was extracted as described before (4,18,19). RNA was treated with TurboDNAfree (Ambion), according to manufacturer's directions.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Expression of a family of noncoding mitochondrial RNAs distinguishes normal from cancer cells

Burzio

Villota

Villegas

et al. 2009

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

112

189

View full text Add to dashboard Cite

We reported the presence in human cells of a noncoding mitochondrial RNA that contains an inverted repeat (IR) of 815 nucleotides (nt) covalently linked to the 5 end of the mitochondrial 16S RNA (16S mtrRNA). The transcript contains a stem-loop structure and is expressed in human proliferating cells but not in resting cells. Here, we demonstrate that, in addition to this transcript, normal human proliferating cells in culture express 2 antisense mitochondrial transcripts. These transcripts also contain stem-loop structures but strikingly they are down-regulated in tumor cell lines and tumor cells present in 17 different tumor types. The differential expression of these transcripts distinguishes normal from tumor cells and might contribute a unique vision on cancer biology and diagnostics.differential expression in cancer ͉ RNAs with stem-loop structures R ecently, we described a novel human mitochondrial transcript of 2,374 nt that contains a long inverted repeat (IR) linked to the 5Ј end of the 16S mitochondrial rRNA (16S mtrRNA) (1, 2), which we designated noncoding mitochondrial RNA or ncmtRNA (2). The IR generates a stem-loop structure with an 820-bp doublestranded region and a 40-nt loop (2). In situ hybridization (ISH) showed that the ncmtRNA is overexpressed in several tumor cell lines but not in nondividing cells, suggesting that the ncmtRNA may play a role in cell proliferation (2).Because the results described before were obtained using tumor cell lines (2), we asked whether the ncmtRNA (from now on, sense ncmtRNA, SncmtRNA) is expressed in normal proliferating cells. Here we show that ISH of human umbilical vein endothelial cells (HUVEC), foreskin keratinocytes (HFK) (3), and human tonsil endothelial cells (HUTEC) (4) also express the SncmtRNA. However, and in striking contrast with tumor cell lines, ISH of normal proliferating cells revealed expression of antisense transcripts. These molecules were identified as 2 unique transcripts containing IRs linked to the 5Ј region of the antisense 16S mtRNA transcribed from the L-strand of the mtDNA (1, 2). We named these transcripts antisense ncmtRNA-1 (ASncmtRNA-1) and antisense ncmtRNA-2 (ASncmtRNA-2). Finally, we show that the antisense transcripts are also expressed in proliferating cells present in normal human tissues but are down-regulated in cells present in human tumors of different types and patients.

show abstract

“…Total RNA from cells and isolated mitochondria was extracted as described before (4,18,19). RNA was treated with TurboDNAfree (Ambion), according to manufacturer's directions.…”

Section: Methodsmentioning

confidence: 99%

“…RNA was treated with TurboDNAfree (Ambion), according to manufacturer's directions. Reverse transcription was carried out on 50 to 100 ng of freshly prepared RNA as described before (2,18,19). The cDNA was PCR amplified and amplicons were cloned and sequenced (2).…”

Section: Methodsmentioning

confidence: 99%

Expression of a family of noncoding mitochondrial RNAs distinguishes normal from cancer cells

Burzio

Villota

Villegas

et al. 2009

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

112

189

View full text Add to dashboard Cite

show abstract

“…Therefore, it might be possible that these putative peptides play a functional role in salmonids. This finding might be another surprise of the pleitrophic features of the 16S mitochondrial RNA in addition to other intriguing properties such as nuclear localization (Villegas et al, 2000;, cytoplasmic localization, the role in the development of the germ cell line (Kobayashi et al, 1998), and the chaperonelike activity (Sulijoadikusumo et al, 2001).…”

Section: Ribosomal and Transfer Rnamentioning

confidence: 95%

“…The DNA was then extracted with the phenol procedure as described (Sambrook et al, 1989). To check for the absence of nuclear salmon DNA, the preparation was used as a template to amplify the 18S ribosomal gene (forward: 5' ACGGCCGGTACAGTGAAACT; reverse: 5' CCAATTACAGGGCCTCGAAA) (Villegas et al, 2000). Those preparations of the bacteria DNA without contamination with salmon DNA were used for sequencing.…”

Section: Dna Isolationmentioning

confidence: 99%

The complete sequence of the mitochondrial genome of the Chinook salmon, Oncorhynchus tshawytscha

Wilhelm

Villegas

Miquel³

et al. 2003

Biol. Res.

Self Cite

View full text Add to dashboard Cite

The complete sequence of the mitochondrial genome of Chinook salmon, Oncorhynchus tshawytscha, has been determined. The circular genome consisting of 16,644 base pairs encodes thirteen proteins, the 12S and 16S ribosomal RNAs, and 22 transfer RNAs. These genes are ordered in the same way as most other vertebrates. The nucleotide and amino acid sequences of the ribosomal RNAs and the thirteen protein-coding genes were compared with those of other salmonids such as Oncorhynchus mykiss, Salmo salar, Salvelinus fontinalis, Salvelinus alpinus and Coregonus lavaretus. The sequence features of the control region (D-loop), the origin of L-strand replication and a putative peptide codified by the 16S mitochondrial RNA are described and discussed.

show abstract

“…In mouse cells, Villegas et al [71,72] identified the presence of a mitochondrial RNA (mtRNA) that contained an inverted repeat (IR) of 121 nucleotides that covalently linked to the 5′ end of the mitochondrial 16S RNA. Later the same workers demonstrated that human cells contain a transcript of 2374 nt with similar structural features to the mouse mtRNA.…”

Section: Noncoding Mitochondrial Rnasmentioning

confidence: 99%

Noncoding RNAs: Different roles in tumorigenesis

Lin

2012

Chin. Sci. Bull.

View full text Add to dashboard Cite

A major portion of the mammalian genome is transcribed to produce large numbers of noncoding RNAs (ncRNAs). During the past decade, the discovery of small RNAs, including the microRNAs (miRNA) and small interfering RNAs (siRNA), has led to important advances in biology. The breadth of the ncRNA field of study has substantially expanded and many recent results have revealed a range of functions that can be attributed to the miRNAs and other ncRNAs. For example, H19 RNA, HOTAIR RNA, transcribed ultraconserved regions (T-UCRs), natural antisense RNA, transfer RNA and mitochondrial noncoding RNA have been suggested to play important roles in cancers and other diseases as well as in diverse cellular processes. In this review, we focus on the current status of several classes of ncRNAs associated with cancer with the emphasis on those that are not microRNAs. Mounting evidence has revealed that a major portion of the mammalian genome is transcribed to produce large numbers of noncoding RNAs (ncRNAs), that is, RNAs that either do not have an open reading frame or RNAs that have a short poorly conserved open reading frame and do not code for a protein [1,2]. During the past decade, the discovery of small RNAs including the microRNAs (miRNAs) and small interfering RNAs (siRNAs) has led to major advances in biology. After miRNAs were first connected to cancer pathogenesis [3], accumulating data have pointed to a central regulatory role for miRNAs in the initiation and progression of most of the cancers that have been analyzed so far. Recently, the breadth of the ncRNA field of study has substantially expanded. A series of studies have revealed the essential roles of many ncRNAs in diverse cellular processes including cancer; these ncRNAs include H19 RNA, HOTAIR RNA, transcribed ultraconserved regions (T-UCRs), natural antisense RNA, transfer RNA and mitochondrial noncoding RNA (Figure 1). In this review, we focus on the current status of the research into the several classes of ncRNAs associated with cancer.

show abstract

A Novel Chimeric Mitochondrial RNA Localized in the Nucleus of Mouse Sperm

Cited by 32 publications

References 35 publications

Expression of a family of noncoding mitochondrial RNAs distinguishes normal from cancer cells

Expression of a family of noncoding mitochondrial RNAs distinguishes normal from cancer cells

The complete sequence of the mitochondrial genome of the Chinook salmon, Oncorhynchus tshawytscha

Noncoding RNAs: Different roles in tumorigenesis

Contact Info

Product

Resources

About