A novel cell‐based sensor detecting the activity of individual basic proprotein convertases

Abstract

The basic proprotein convertases (PCs) furin, PC1/3, PC2, PC5/6, PACE4, PC4, and PC7 are promising drug targets for human diseases. However, developing selective inhibitors remains challenging due to overlapping substrate recognition motifs and limited structural information. Classical drug screening approaches for basic PC inhibitors involve homogeneous biochemical assays using soluble recombinant enzymes combined with fluorogenic substrate peptides that may not accurately recapitulate the complex cellular context of the basic PC–substrate interaction. Herein we report basic PC sensor (BPCS), a novel cell‐based molecular sensor that allows rapid screening of candidate inhibitors and their selectivity toward individual basic PCs within mammalian cells. BPCS consists of Gaussia luciferase linked to a sortilin‐1 membrane anchor via a cleavage motif that allows efficient release of luciferase specifically if individual basic PCs are provided in the same membrane. Screening of selected candidate peptidomimetic inhibitors revealed that BPCS can readily distinguish between general and selective PC inhibitors in a high‐throughput screening format. The robust and cost‐effective assay format of BPCS makes it suitable to identify novel specific small‐molecule inhibitors against basic PCs for therapeutic application. Its cell‐based nature will allow screening for drug targets in addition to the catalytically active mature enzyme, including maturation, transport, and cellular factors that modulate the enzyme's activity. This broadened ‘target range’ will enhance the likelihood to identify novel small‐molecule compounds that inhibit basic PCs in a direct or indirect manner and represents a conceptual advantage.

Luminescent reporter cells enable the identification of broad‐spectrum antivirals against emerging viruses

“…The basic PC sensor BPCS has previously been described 18 . The V5‐tag was removed from BPCS by excision of the Xho I/ Cla I fragment and was replaced with a Xho I/ Cla I digested PCR product amplified from the same original pcDNA 3.1 IntA BPCS plasmid using the forward and reverse primers 5′‐AGCCGCTCGAGGATATCACTTCTGTTCCAATTATCCTGGCC‐3′ and 5′‐AGCCGATCGATGCACCAGGAACCTTCCCCC‐3′, respectively.…”

“…16 demonstrating specificity for furin. 18 Given the low homology between the two PCs, SKI-1/S1P and furin, inhibition through binding of monensin to the catalytic pocket is an unlikely mechanism of action. Monensin is a polyether ionophore transporting monovalent cations, preferentially Na + , across membranes in exchange for H + , thereby dismantling luminal proton gradients of various subcellular compartments.…”

“…To that end, we generated stable SKI-1/S1P and furin sensor cell lines, named luminescent inducible proprotein convertase reporter (LIPC) cells, based on previously reported sensor constructs. [16][17][18][19] To avoid sensor competition with endogenous substrates of SKI-1/S1P or furin during the selection process, we opted for stable, doxycycline inducible, sensor cell lines. We engineered four LIPC lines accounting for the different subcellular compartments, in which GP cleavage occurs.…”

“…Since most cell lines, including HEK293 used here to establish inducible sensor lines, express multiple basic PCs, we designed the furin sensor in a way that endogenous levels of basic PCs would not be sufficient to yield detectable sensor cleavage.Instead of incorporating a viral GP consensus sequence for efficient furin cleavage, we picked a noncanonical, inefficiently cleaved furin motif from a cellular substrate, POMC. Our furin sensor thus consisted from N-to C-terminus of Gaussia luciferase, an extended, POMC-derived basic PC cleavage site and a sortilin-1 membrane anchor directing the sensor to compartments of furin expression18 (Figure2A, top). Only after co-overexpression of a basic PC, here furin, sensor cleavage becomes apparent, and reduced cleavage in presence of a drug can thus unequivocally be assigned to furin inhibition.…”

“…Only after co-overexpression of a basic PC, here furin, sensor cleavage becomes apparent, and reduced cleavage in presence of a drug can thus unequivocally be assigned to furin inhibition. In previous studies, this basic PC sensor design has been successfully used in transient cotransfection experiments with furin to screen a small selection of peptidomimetic inhibitors 18. For generation of our stable, inducible furin sensor line we, therefore, inserted human furin and the above described furin sensoras a bi-cistronic construct linked by an IRES into the unique FRT locus in Flp-In™ T-Rex-293 host cells.…”