A Novel Approach to CFTR Mutation Testing by Pyrosequencing-Based Assay Panels Adapted to Ethnicities

Abstract

Background: Cystic fibrosis (CF) is a common autosomal recessive genetic disorder caused by a variety of sequence alterations in the CFTR gene [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)]. Because the relative prevalence of mutations strongly depends on the ethnic background, first-level testing of CF as defined by recent consensus recommendations ought to be adaptable to the ethnicity of patients. Methods: We therefore developed and implemented a diagnostic approach to first-level testing for CF based on published mutation frequencies and Pyrosequencing (PSQ) technology that we complemented with standard procedures of mutation detection at the second level. Results: The current test system of PSQ assays for 46 target CF mutations [including CFTRdele2,3 (21 kb) and 1342-6 (T)n (5T/7T/9T)] permits recombinations of single assays to optimize sensitivities for certain ethnicities. By easy expansion of the original mutation panel, the first-level test sensitivities with other ethnic groups would be increased, provided that the mutation frequencies are known. The test was validated with our local, ethnically mixed, but mainly German population (155 patients). The mutation-detection rate for the 92 patients whose CF was confirmed by the sweat test was 89.0% for the patients of German descent (73 of the 92 patients) and 73.7% for the patients of any other origin (19 of the 92 patients). Ethnicity-adapted testing panels for our foreign CF patients would increase the sensitivities for the respective groups by approximately 5%. Conclusions: PSQ-based genotyping is a reliable, convenient, highly flexible, and inexpensive alternative to conventional methods for first-level testing of CFTR, facilitating flexible adaptation of the analyzed mutation panel to any local ethnic group.

Second MAFA Variant Causing a Phosphorylation Defect in the Transactivation Domain and Familial Insulinomatosis

“…Sanger Sequencing (Beckman CEQ8000, Sciex, Darmstadt, Germany; Wenzel et al [ 19 ]) and multiplex ligation-dependent probe amplification (SALSA MLPA Probemix P017, MRC Holland, Amsterdam, The Netherlands) were used for MEN1 testing prior to WES and to confirm the variants detected by WES. Targeted analysis of family members was performed by Sanger- or pyrosequencing (PyroMark Q96 ID, Qiagen, Hilden, Germany), as described previously [ 20 ], with PCR primers (Integrated DNA Technologies, Coralville, Iowa, USA), and the conditions adapted to the current analytics (primers for Sanger sequencing: MAFA_T57R.for ACGACTTCGACCTGATGAAGTTCG, MAFA_T57R.rev CCCCGGCCTGAGACGAGC, PROX1_A394T.for CTGCCATGTCGCAAGTTGTG, PROX1_A394T.rev AACTGGCCATCTGCACATTG; primers for pyrosequencing: MAFA_T57R_PSQ.for 5′ Biotin tagged CGCCAGGCTCGCTGTCCT, MAFA_T57R_PSQ.rev GGCACGGAGGAGCAGGG, MAFA_T57R_PSQ.Rseq ACGGAGGAGCAGGGC, dispensation order TCGTGCTG).…”

Molecular Biologic Techniques in Cytopathologic Diagnosis

“…[19][20][21][22] This technique could be used to detect known hot-spot mutations such as BRAF, EGFR, K-RAS, CFTR, BRCA1, BRCA2, and PIK3CA. 19,[23][24][25][26][27][28] It can also be applied to quantitative CpG island methylation analysis. 29 BRAF T1799A mutation analysis using pyrosequencing PCR primer sequences for the amplification of BRAF T1799A mutation site are 5′ -biotin-CTTCATAATGCTTGCTCTGA-TAGG-3′ (F) and 5′ -GGCCAAAAATTTAATCAGTGGA A-3′ (R).…”

A New Targeted CFTR Mutation Panel Based on Next-Generation Sequencing Technology

“…Consequently, several efforts have been made to develop experimental approaches based on selected panels of known CF-causing mutations. 31,32 In this case, the DR of the selected panel of mutations in populations of various ethnographic origins and/or with various CF clinical forms invariably arose as a crucial variable. 17 NGS platforms seem to be particularly suited to the development of mutation panels with high a mutation number and, consequently, a high DR.…”