A novel (288delC) mutation in exon 2 of GPIIb associated with type I Glanzmann's thrombasthenia

Abstract

This work reports the molecular genetic analysis of two patients who suffer mucocutaneous haemorrhages, prolonged bleeding time and failure of platelets to aggregate, either spontaneously or in response to agonists. The absence of platelet surface glycoprotein (GP)IIb-IIIa complexes confirmed the clinical diagnosis of Glanzmann's thrombasthenia (GT). Polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) analysis of exon 2 of GPIIb showed polymorphic bands caused by the homozygous deletion of a cytosine at position 288 relative to the translation start site. causing a shifting of the reading frame and appearance of a premature termination codon. The heterozygous relatives showed a reduced platelet content of GPIIb-IIIa, and a correlation was found between the levels of GPIIb mRNA and surface expression of GPIIb-IIIa complexes. Unlike other mRNAs carrying a nonsense mutation, (288Cdel)GPIIb does not force alternative splicing of GPIIb mRNA. As expected, co-transfection of Chinese hamster ovary (CHO) cells with cDNAs encoding GPIIIa and (288delC)GPIIb failed to enhance the surface exposure of GPIIIa. It is concluded that the (288delC)GPIIb mutation is responsible for the thrombasthenic phenotype of the patients. In addition, it has also been determined that heterodimerization of GPIIb-IIIa requires the integrity of exons 2 and 3 of GPIIb.

A novel homozygous splice junction mutation in GPIIb associated with alternative splicing, nonsense-mediated decay of GPIIb-mRNA, and type II Glanzmann's thrombasthenia

“…The exontrap analysis has been previously used to study GPIIb mutations associated with thrombasthenic phenotypes [11]. However, in our case its use was limited by the lack of splicing signals for the first exon.…”

“…Amplification of DNA was carried out with Taq polymerase according to the protocol recommended by Perkin‐Elmer Roche (Branchburg, NJ, USA). Fragments of DNA encompassing one or more exons of GPIIb were amplified and sequenced as previously reported [11]. A fragment of genomic DNA encompassing the exon 1–intron 1 junction was amplified using the oligonucleotide pair: sense, 5′‐GTTGTGGAAGAAGGAAG‐3′, and antisense, 5′‐TATCGCAAATGGGAAACTCG‐3′.…”

“…Quantification of platelet GPIIb and GPIIIa mRNAs of the proband, both parents, and normal individuals was performed with the reverse transcriptase (RT)‐PCR‐based TaqMan System (Perkin‐Elmer Roche) as previously described [11]. One‐step RT‐PCR was carried out with MuLV (Murine Leukemia Virus)‐reverse transcriptase followed by amplification with preactivated AmpliTaq Gold DNA Polymerase.…”

“…To circumvent this problem, we prepared a construct in which an extra exon was placed prior to exon 1 of GPIIb. This was achieved with a previously used exontrap construct of genomic DNA containing exons 2–9 of GPIIb and the adjacent intronic regions [11]. First, this construct was partially digested with Pvu II and totally with Sma I to release a fragment extending from the 3′‐end of exon 3 to the middle of intron 8.…”

“…The orientation of the inserts was verified by sequencing. The exontrap vectors containing the chimeric normal or mutant GPIIb DNA fragments were transiently transfected into CHO‐IIIa cells by the calcium phosphate precipitation method and, 48 h later, total RNA was extracted and RT‐PCR amplified as previously described [11].…”