A novel 223 kb deletion in the beta‐globin gene cluster was identified in a Chinese thalassemia major patient

Abstract

Introduction Although mutations in the human beta‐globin gene cluster are essentially point mutations, several large deletions have been described in recent years. Methods We have identified a novel 223 kb deletion in a Chinese patient by multiplex ligation‐dependent probe amplification and characterized it by next‐generation sequencing, Gap‐PCR, and DNA sequence analysis. Results The deletion extends from the 3′UTR of the δ globin gene (HBD) to 215 kb downstream of the HBB. Compound heterozygous with the typical β‐thalassemia—CD41‐42(‐CTTT) mutation, the proband presented with microcytosis and hypochromic red cells, and required regulate transfusion. The patient was clinically diagnosed with thalassemia major. Conclusion Our study widens the mutation spectrum of β‐thalassemia. In addition, this case may spark future studies of the regulatory regions of the beta‐globin gene cluster.

Molecular Epidemiology and Hematologic Characterization of Thalassemia in Guangdong Province, Southern China

“…When encountering rare thalassemia mutations in clinical applications, more methods are needed, such as Sanger sequencing of the entire globin gene, MLPA, specific primer Gap-PCR, and even next-generation sequencing (NGS), to verify the precise breakpoint. 27 , 30 , 31 In our study, two different company kits, Yaneng and Yishengtang, were used to detect conventional thalassemia, and there was no difference in the results, indicating that both of them can meet the needs of clinical practice. It was found that the hematology results of some patients with thalassemia silent had no different from those of normal people, so traditional testing schemes are likely to cause missed diagnoses.…”

Case Report: The third-generation sequencing confirmed a novel 7.2 Kb deletion at β-globin gene in a patient with rare β-thalassemia

“…Although variations in the β-thalassemia was mainly due to point mutations, several large deletions had been described in recent years ( Zhu et al, 2019 ). Due to the technical limitations, many breakpoints of large deletions in the β-globin gene cluster were not confirmed ( Rooks et al, 2012 ).…”

“…Due to the technical limitations, many breakpoints of large deletions in the β-globin gene cluster were not confirmed ( Rooks et al, 2012 ). Research had shown that there were multiple cis-elements located in the β-globin gene cluster that could regulate the expression of the globin genes ( Thein, 2013 ; Zhu et al, 2019 ). Therefore, ascertaining the breakpoints of deletions was important for hemoglobinopathy research ( Hu et al, 2016 ).…”

Characterization and identification of Prachinburi β0‐thalassemia: A novel‐60 kb deletion in beta globin gene related to high levels of Hb F in heterozygous state

“…The 50 μL PCR mixtures included 3 μL of 50 μg/μL genomic DNA, 5 μL of 10X buffer (Vivantis Technologies), 2 μL of dNTPs (5 mmol/L), 2 μL of MgCl 2 (50 mmol/L), 1 μL of F1 (GGCCTAAAACCACAGAGAGT) 9 and R1 (CCAGAAGCGAGTGTGTGGAA) 9 primers (10 µmol/L), 2 μL of F4 (TCAGAAGCAGAGCTACTCAG) 10 To date, β-thalassemia in Thailand and South East Asia has been reported with a high prevalence of point mutations or a small deletion in the β-globin gene, while large deletional β-thalassemia (β 0thalassemia) in this region has been documented with only 3.5-kb deletion β 0 -thalassemia and Filipino β 0 -thalassemia. 2,3,10,11 However, Dutch β 0 -thalassemia and β 0 -thalassemia in southern Italy have also been characterized as large β 0 -thalassemias, which are prevalent in Europe but not in Asia (Figure 3B). 12 In this study, we firstly characterized the novel Prachinburi β 0 -thalassemia which related to 60 151 bp (60 kb) deletion, using MPLA and NGS analysis.…”

“…Moreover, other large deletions of the β-globin gene cluster have been reported and characterized into (εγδβ) 0 -thalassemia, ( G γ A γδβ) 0 -thalassemia, G γ( A γδβ) 0 -thalassemia, and (δβ) 0 -thalassemia which are represented by low Hb A 2 levels, caused by the δ-globin gene deletion. 3 In contrast, large deletional β 0 -thalassemia will be related to high Hb A 2 levels. 4 In Thailand and South East Asia, two common large deletional β 0 -thalassemias have been documented, related to β 0 -thalassemia 3.5-kb deletion and Filipino β 0 -thalassemia (116 kb deletion).…”