A new mouse T-cell receptorα chain variable region family

SummaryExperimental allergic encephalomyelitis (EAE) is an autoimmune disease that can be induced in laboratory animals by immunization with the major myelin proteins, myelin basic protein (MBP) and proteolipid protein (PLP). We analyzed the role of the T cell receptor (TCR) repertoire in susceptibility to EAE induced by these two autoantigens. Autoreactive T cells induced after immunization with MBP use a limited set of TCR. In contrast, we demonstrate that T cell clones that recognize the encephalitogenic PLP epitope (PLP 139-151) use diverse TCR genes. When the TCR. repertoire is limited by introduction of a novel rearranged TCR V/~ 8.2 chain in transgenic SJL mice, EAE could be induced in the transgenic mice by immunization with the encephalitogenic epitopes of PLP, but not with the encephalitogenic epitope of MBP. Thus, skewing the TCR repertoire affects the susceptibility to EAE by immunization with MBP but not with PLP. These data demonstrate the biological consequences of the usage of a more diverse T cell repertoire in the development of an autoimmune disease. E xperimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS) (1), can be induced in laboratory animals by immunization with the major myelin proteins, myelin basic protein (MBP) or myelin proteolipid protein (PLP) (2, 3). The EAE that results from immunization with MBP is mediated by T cells that utilize limited sets of TCR (4-6). PLP, which constitutes the bulk of the myelin proteins in the central nervous system (CNS), is an equally important candidate antigen for MS. A panel of T cell clones specific for the encephalitogenic epitope of PLP 139-151 was recently isolated and characterized (7). Cloning and sequencing of the TCR genes reveals that diverse TCR c~/~ chains are used by these clones. We demonstrate the consequence of the diversity of TCR gene usage in response to PLP and MBP by analyzing the effect of skewing the TCR repertoire on the pathogenesis and susceptibility to EAE in SJL-TCR. V/3 8.2 transgenic mice. Materials and MethodsAnimals. Female SJL/J mice (4-8-wk-old) were from the Jackson Laboratory (Bar Harbor, ME). Transgenic mice were produced by injecting the TcR/~ chain construct (V/~ 8.2-D/31.1-JBI.I-CB2) (8), derived from an OVA-specific T cell hybridoma, into the product of a (C57BL/6 x SJL)F: mating. The founder animal was backcrossed twice to SJL/J mice and the offspring were H-2 typed. The H-2 s/~ homozygotes were then backcrossed an additional four times to SJL/J mice. This strain was termed SJL transgenic and was maintained by backcrosses to SJL mice. In all experiments, nontransgenic mice were littermates of transgenic mice.Antigens. Whole mouse myelin was prepared from the brains and spinal cords by the method of Norton and Poduslo (9). The MBP and PLP peptides used in the study were: MBP 89-101

Section: Resultsmentioning

confidence: 99%

T cell receptor (TCR) usage determines disease susceptibility in experimental autoimmune encephalomyelitis: studies with TCR V beta 8.2 transgenic mice.

Kuchroo

Collins

Al‐Sabbagh

et al. 1994

“…PCR was done in a thermocycler TempTronic (Thermolyne Corp., Dubuque, IA) on 1/20 of the reverse-transcription reaction using 15 pmol Vc~ primer and 20 pmol Caa primer in a 50-gl reaction volume. Primers used were Val, Va4, Vc~5/7, Va6/12, VaS, Va11, Va15 (12); Caa, Va2, Va3, Va9, Val0, Va34S-281, VaBMA, VcrBMB, VaA10, Va13.1, VaBWB, Va5T (13,14); and Va21 primer 5'-CAGCGCTGTCATCAACTGCA-3' (15). Reactions were heated to 94~ for 3 min, followed by four cycles of 97~ for 60 s, 52~ for 30 s, 72~ for 60 s, and 30 cycles of 94~ for 45 s, 52~ for 30 s, and 72~ for 60 s. PCR products (7 gl) were electrophoresed on a 3% agarose gel (NuSieve; FMC Corp., Rockland, ME) and visualized with ethidium bromide.…”

Section: Methodsmentioning

confidence: 99%

Modulation of T cell development by an endogenous altered peptide ligand.

Hsu

Evavold

Allen

1995

SlutlnlTlal~T cells potentially encounter numerous endogenous peptides during selection in the thymus and in the periphery. We examined the impact of an endogenous peptide on in vivo T cell development, using a TCR transgenic mouse model based on a hemoglobin-specific T cell clone. In these mice, the transgenic ~ chains paired with endogenous ot chains. This led to a serendipitous primary reactivity to Set69 peptide, an altered peptide ligand of the Hb a (64-76) epitope of the parent clone. Two Ser69-reactive T cell populations were identified. A smaller population of the Ser69-reactive T cells responded both to . A majority reacted only to Set69, and not to Hba(64-76); in fact, Hba(64-76) was a specific TCR antagonist for these Ser69-onlyreactive T cells. Thus, in this unique experimental system, Ser69 became an agonist, and Hb a (64-76) was an antagonist. Endogenous presentation of the antagonist ligand in the thymus selectively eliminated the high-avidity cells, while sparing low-avidity cells in the Ser69-reactive T cell repertoire. These results highlight how specificity guides developing T cells through a network of ligands and indicate that the endogenous peptide pool has a profound effect on T cell development and repertoire.T he antigen specificity of the TCR is central to the triggering of T cell activation, clonal expansion, and effector functions. The TCR recognizes its antigen in the form of a peptide bound to an MHC molecule. Studies using variants of antigenic peptides have shown that the TCR responds selectively to subtle changes in the ligand, underscoring its ability to behave as more than an all-or-none switch (1, 2). We have approached these issues of T cell recognition by characterizing the T cell response to the B chain of murine hemoglobin, a protein with two allelic forms, Hbb s and Hbb d. The single antigenic determinant Hb ~a~n~ (64)(65)(66)(67)(68)(69)(70)(71)(72)(73)(74)(75)(76) [hereafter referred to as Hbd(64-76)] binds to I-E k and is expressed as a self-antigen in CBA/J (Hbb a) mice, while it is recognized as foreign in CE/J (Hbb s) mice. Using variants of Hba(64-76), termed altered peptide ligands (APL), we have demonstrated the induction of selective functions in T cell clones and hybridomas, including lymphokine production or cytolysis without proliferation (3, 4), anergy induction (5, 6), and TCR antagonism (4). We report here a transgenic mouse expressing the/3 chain of the TCR from a Hbd(64-76)/I-Ek-specific T cell clone, which has a fortuitous primary reactivity to an APL of Hbd(64-76). We introduced the Hbd(64-76)-determinant into the pool of endogenous peptide ligands by crossing these mice with Hbbd-expressing mouse strains and examined the effect of endogenous APL on thymic selection. (Princeton, NJ). Founder transgenic mice (G2-Tg) were obtained and backcrossed twice to CE/J mice to introduce the I-E k restriction element and maintain homozygosity of the Hbb s allele. PCR amplification of the a transgene from tail digests identified transgenic progeny (9). Mice used in...

“…The JB1.2 and JB1,4 primers will be reported elsewhere (Pannetier et al, manuscript in preparation). Sequences of the newly designed primers specific for the Vc~T2.5-5 (18) and V~B6.2.16 subfamilies (19) are CAGAAAACAGAGCCAAAGAC and GAGACACCGTTGTTAAAGGC, respectively. The other primers were previously described (15).…”

Section: Methodsmentioning

confidence: 99%

T cell receptor selection by and recognition of two class I major histocompatibility complex-restricted antigenic peptides that differ at a single position.

Casanova

Martinon

Gournier

et al. 1993

SummaryPeptides derived from HLA-Cw3 and HLA-A24 within region 170-179 differ by a single substitution, at position 173, and are both presented by the dass I major histocompatibility complex molecule H-2K a for recognition by routine cytolytic T lymphocytes (CTLs). As a first approach to understand the way T cell receptors (TCRs) intact with the HLA peptides, we have analyzed the TCR selection by, and recognition of, the two HLA antigenic sites. First, we have compared the TCR repertoires selected by HLA-Cw3 and HLA-A24, not only by sequencing the TCRs carried by CTL clones isolated and grown in vitro, but also by analyzing the TCRs expressed in vivo by peritoneal exudate lymphocytes from immune animals. Second, we have compared the TCR crossrecognition of HLA-A24 by CTLs selected by HLA-Cw3 with that of HLA-Cw3 by CTLs selected by HLA-A24. The combined analysis of TCR selection by and recognition of these two related HLA antigenic sites provides evidence that the TCR/3 junctional regions interact with the amino-terminal part of the HLA peptides. CTLs recognize antigenic peptides presented by class I MHC molecules (1, 2). The specificity of this recognition is conferred by the TCR ot//~ (3, 4). Whereas the structure of several class I MHC molecules, and that of a class I MHC-peptide complex, were determined by crystallographic studies (5), such information is not available yet for the TCR. However, a model of the TCR ol/B tertiary structure was proposed, based on its homology with Igs (6). In any case, experimental evidence is lacking so far to support a topology of class I MHC-peptide recognition by TCRs.We previously reported that DBA/2 mice could mount a CTL response towards two related antigens, HLA-Cw3 and HLA-A24, in the context of the same murine class I MHC molecule, H-2K a, and that a fraction of the CTLs raised in response to either HLA antigen was not reactive to the second HLA antigen (7). The optimal synthetic peptides recognized by these specific CTLs, corresponding to the region 170-179, differ by a single nonconservative substitution at position 173 and bind their common restriction element H-2K d with a similar affinity (Table 1) (8--12). Regions 170-179 of the related HLA molecules A2 and A3 are identical to HLA-A24 and can also be recognized by H-2Ka-restricted CTLs (13).We recently showed that the TCRs carried by H-2K arestricted CTLs specific for the Cw3 170-179 peptide were very limited in primary structure (14). They were encoded by few germline gene segments: a single VB segment ORB10), a singleJo~ segment (Jc~pHDS58), few Vot segments (mainly Vc~3,4,8), and few J/~ segments (mainly J/31.2, 1.4, 2.3). Thdrjunctional CDR3 c~ and/3 loops also displayed limited diversity: a single length of nine and six amino adds, respectively, a conserved non-V-, non-J-encoded glydne amino acid at position 97 in the CDR3/~, and a high occurrence of non-J-encoded glycine or charged amino acids at positions 94 and 95 in the CDR3 c~. As a first approach to understand the topology of interaction of TCRs with...