A new method of metabarcoding Microsporidia and their hosts reveals high levels of microsporidian infections in mosquitoes (Culicidae)

Abstract

DNA metabarcoding offers new perspectives, especially with regard to the highthroughput identification and diagnostics of pathogens. Microsporidia are an example of widely distributed, opportunistic and pathogenic microorganisms in which molecular identification is important for both environmental research and clinical diagnostics. We have developed a method for parallel detection of both microsporidian infection and the host species. We designed new primer sets: one specific for the classical Microsporidia (targeting the hypervariable V5 region of small subunit [ssu] rDNA), and a second one targeting a shortened fragment of the COI gene (standard metazoan DNA-barcode); both markers are well suited for next generation sequencing. Analysis of the ssu rDNA data set representing 607 microsporidian species (120 genera) indicated that the V5 region enables identification of >98% species in the data set (596/607). To test the method, we used microsporidians that infect mosquitoes in natural populations. Using mini-COI data, all field-collected mosquitoes were unambiguously assigned to seven species; among them almost 60% of specimens were positive for at least 11 different microsporidian species, including a new microsporidian ssu rDNA sequence (Microsporidium sp. PL01). Phylogenetic analysis showed that this species belongs to one of the two main clades in the Terresporidia. We found a high rate of microsporidian co-infections (9.4%). The numbers of sequence reads for the operational taxonomic units suggest that the occurrence of Nosema spp. in co-infections could benefit them; however, this observation should be retested using a more intensive host sampling. Our results show that DNA barcoding is a rapid and cost-effective method for deciphering sample diversity in greater resolution, including the hidden biodiversity that may be overlooked using classical methodology.

Metabarcoding reveals low prevalence of microsporidian infections in castor bean tick (Ixodes ricinus)

“…DNA barcode covering 322 bp from the 5′ end of the COI gene (mini-COI) was amplified using bcdF01 (CATTTTCHACTAAYCATAARGATATTGG) [ 32 ] and bcdR06 (GGDGGRTAHACAGTYCAHCCNGT) [ 29 ] primers tailed at 5′ ends with dual-indexed adapters (forward tail: CCATCTCATCCCTGCGTGTCTCCGACTCAG-index-GAT, reverse tail: CCTCTCTATGGGCAGTCGGTGAT-index) for sequencing using the Ion Torrent system (Life Technologies, USA). PCR amplification was performed in a 5-µl volume containing Hot FIREPol DNA Polymerase (Solis BioDyne, Estonia), 0.25 µM of each tailed primer and 1 µl of template DNA.…”

“…The hypervariable V5 region of 18S rRNA gene (18S rDNA) was amplified in two technical replications using the microsporidian-specific primer set CM-V5F (GATTAGANACCNNNGTAGTTC) and CM-V5R (TAANCAGCACAMTCCACTC) [ 29 ]. PCR reactions were done in a total volume of 10 µl containing Hot FIREPol DNA Polymerase, 0.25 µM of each tailed primer and 1 µl of template DNA.…”

“…A large fragment of the 18S rRNA gene, covering V1-V5 hypervariable regions, was amplified using V1F (CACCAGGTTGATTCTGCCTGAC) [ 40 ] and CM-V5R (TAANCAGCACAMTCCACTC) [ 29 ] primers. PCR reactions were prepared in two technical replicates, each in a total volume of 10 µl containing Hot FIREPol DNA Polymerase, 0.25 µM of each primer and 1 µl of template DNA.…”

Introduction to Molecular Diagnostics of Insects

“…Примером здесь может служить выявление микроспоридий и различных вирусов (бакуловирусы, парвовирусы) у таких экономически значимых насекомых, как Apis mellifera, Bombus terrestris, китайский дубовый шелкопряд Antheraea pernyi, тутовый шелкопряд Bombix mori (Erler et al, 2012;Wu et al, 2017;Li et al, 2019). Разработка протоколов секвенирования следующего поколения (NGS) позволяет одновременно (параллельное секвенирование) выявлять как разнообразие микроспоридий, так и устанавливать видовую принадлежность хозяев (Trzebny et al, 2020). Кроме того, эти протоколы позволяют обнаруживать ранее неописанное (криптическое) разнообразие патогенов, что особенно важно в случаях микс-инфекции микроспоридий (Trzebny et al, 2020), а среди массовых видов мелких двукрылых -выявлять редкие виды (Meier et al, 2015).…”

“…Разработка протоколов секвенирования следующего поколения (NGS) позволяет одновременно (параллельное секвенирование) выявлять как разнообразие микроспоридий, так и устанавливать видовую принадлежность хозяев (Trzebny et al, 2020). Кроме того, эти протоколы позволяют обнаруживать ранее неописанное (криптическое) разнообразие патогенов, что особенно важно в случаях микс-инфекции микроспоридий (Trzebny et al, 2020), а среди массовых видов мелких двукрылых -выявлять редкие виды (Meier et al, 2015).…”