A mutation at the Ala122 position of acetohydroxyacid synthase (AHAS) located on chromosome 6D of wheat: improved resistance to imidazolinone and a faster assay for marker assisted selection

Li, D.; Barclay, I.; Jose, Kim; Stefanova, Katia; Appels, R.

doi:10.1007/s11032-008-9168-4

Cited by 20 publications

(27 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The PCR protocol of Li et al (2008) confirmed the PCR and TaaI digestion results from the Neudorf and Matus‐Cádiz (2009) protocol (Fig. 4).…”

Section: Resultssupporting

confidence: 78%

“…Two separate PCR reactions were used to detect the two alleles. The gene‐specific primer ImiD‐For (TTACAGTTGTTGACATTGACGGT) was paired with either the mutant allele ImiMu‐Rev (TCCTTGAAAGCACCATCGT) or the wild‐type allele primer ImiWt‐Rev (TCCTTGAAAGCACCATCGC) to amplify 390‐bp fragments (Li et al (2008)) The presence of a 390‐bp band in both PCR reactions confirms the presence of both alleles. Each PCR reaction contained 1X PCR buffer (1.5mM MgCl 2 ), 200 μM dNTPs, 1.0 units Hotstart Taq DNA Polymerase, 250 nM of each primer, and approximately 25 ng of genomic DNA.…”

Section: Methodsmentioning

confidence: 98%

“…The protocol described by Li et al (2008) was used for confirmation of the PCR and TaaI digestion results, to determine if the resistant samples were indeed heterozygous, that is, contained both the wild‐type (Ser 653 ) and mutant (Asn 653 ) alleles, and to ensure that the mutant allele was absent and the wild‐type allele present in samples classified as IMI‐susceptible. Two separate PCR reactions were used to detect the two alleles.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Pollen‐Mediated Gene Flow in Commercial Fields of Spring Wheat in Western Canada

et al. 2011

View full text Add to dashboard Cite

RESEARCHN umerous biological, environmental, and crop management factors and their interactions infl uence the frequency and distance of pollen-mediated gene fl ow (PMGF) between donor and receptor fi elds, including type of vector (wind and/or insect), genotype or cultivar, fertility (e.g., male-fertile or -sterile receptor plants), pollen viability and longevity, synchrony of fl owering or pollen production, wind speed and direction, air turbulence or convective air currents, temperature, humidity, and area and plant density of donor and receptor populations (Beckie and Hall, 2008). At a landscape or regional scale, additional factors infl uencing PMGF are topography, vegetation, distribution and abundance of volunteer and feral populations, and number, shape, and spatial arrangement of pollen donor and receptor fi elds.The frequency of PMGF generally declines rapidly with increasing distance from the donor fi eld, often described by a leptokurtic curve, that is, higher probability distribution in the tail than predicted by a normal distribution. The length and shape of the asymptote tail depends on the species, environment, and limits of transgene or phenotypic detection and can be the result ABSTRACT Crop intraspecifi c pollen-mediated gene fl ow (PMGF) can be scale dependent. In 2004-the fi rst year imidazolinone (IMI)-resistant spring wheat (Triticum aestivum L.) was commercially available-a study was conducted in western Canada to examine PMGF in commercial fi elds. At each of two sites located 4 km apart in the semiarid grassland region of Saskatchewan, PMGF was measured from a 16-ha (400 × 400 m) fi eld of IMI-resistant wheat (cultivar CDC Imagine) to an adjacent fi eld of conventional (non-IMI-resistant) wheat (cultivar AC Barrie) with the same dimensions. Wheat grain samples of AC Barrie were collected at varying distances to 400 m along fi ve equally-spaced transects oriented perpendicular to the common border with CDC Imagine. A total of 2000 seedlings per sample were screened for resistance to imazamox at 200 μM in a 7-d soilless bioassay. Putative resistant hybrids were confi rmed by polymerase chain reaction (PCR) analysis. Averaged across transects and sites, PMGF was 0.2% at the common border and declined exponentially with increasing distance; the maximum distance that PMGF was detected was 80 m from the donor fi eld. Higher levels of PMGF were generally observed in this study compared with that of previous studies in western Canada. Results of this study provide a more complete assessment of PMGF in this crop under western Canadian climatic conditions. Together with previous studies, frequency and distance of PMGF can guide grower stewardship practices for identify preservation in wheat cultivars possessing different traits.

show abstract

“…The PCR protocol of Li et al (2008) confirmed the PCR and TaaI digestion results from the Neudorf and Matus‐Cádiz (2009) protocol (Fig. 4).…”

Section: Resultssupporting

confidence: 78%

Section: Methodsmentioning

confidence: 98%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Pollen‐Mediated Gene Flow in Commercial Fields of Spring Wheat in Western Canada

et al. 2011

View full text Add to dashboard Cite

show abstract

“…Nine mutations of the ALS gene in the amino acid positions Ala122, Pro197, Ala205, Asp376, Arg377, Trp574, Ser653, Ser654 and Ser 627 imparts resistance to ALS-inhibiting herbicides (Tan and Evans Singh 2006, Rodríguez-Suárez et al 2009, Li et al 2008, Tranel et al 2014. One of these mutations, Trp574, grants cross-resistance to all ALS-inhibiting herbicides (Tan and Evans Singh 2006).…”

Section: Introductionmentioning

confidence: 99%

“…One of these mutations, Trp574, grants cross-resistance to all ALS-inhibiting herbicides (Tan and Evans Singh 2006). The codon Pro197 mutation is the one most tolerant to sulfonylureas; mutations at Ala122, Ala205 and Ser653 give resistance to IMIs (Tan and Evans Singh 2006), with Ala122 conferring higher levels of resistance to IMIs than Ser653 (Li et al 2008). The last known mutation at position Ser-Asn627 is responsible for resistance in Tritordeum (Rodríguez-Suárez et al 2009).…”

Section: Introductionmentioning

confidence: 99%

Physiological, biochemical and molecular characterization of an induced mutation conferring imidazolinone resistance in wheat

Jiménez¹,

Rojano-Delgado

Fernández

et al. 2016

Physiologia Plantarum

View full text Add to dashboard Cite

The Clearfield(®) wheat cultivars possessing imidazolinone (IMI)-resistant traits provide an efficient option for controlling weeds. The imazamox-resistant cultivar Pantera (Clearfield(®) ) was compared with a susceptible cultivar (Gazul). Target and non-target mechanisms of resistance were studied to characterize the resistance of Pantera and to identify the importance of each mechanism involved in this resistance. Pantera is resistant to imazamox as was determined in previous experiments. The molecular study confirmed that it carries a mutation Ser-Asn627 conferring resistance to imazamox in two out of three acetolactate synthase (ALS) genes (imi1 and imi2), located in wheat on chromosomes 6B and 6D, respectively. However, the last gene (imi3) located on chromosome 6A does not carry any mutation conferring resistance. As a result, photosynthetic activity and chlorophyll content were reduced after imazamox treatment. Detoxification was higher in the resistant biotype as shown by metabolomic study while imazamox translocation was higher in the susceptible cultivar. Interestingly, imazamox metabolism was higher at higher doses of herbicide, which suggests that the detoxification process is an inducible mechanism in which the upregulation of key gene coding for detoxification enzymes could play an important role. Thus, the identification of cultivars with a higher detoxification potential would allow the development of more resistant varieties.

show abstract

An ALA₁₂₂THR substitution in the AHAS/ALS gene confers imazamox‐resistance in Aegilops cylindrica

Rodríguez

Hauvermale

Carter

et al. 2021

Pest Management Science

View full text Add to dashboard Cite

BACKGROUND Wheat growers have limited herbicide options to manage Aegilops cylindrica Host (jointed goatgrass), with many relying on mesosulfuron or imazamox in Clearfield™ winter wheat. Both imazamox and mesosulfuron inhibit acetohydroxyacid synthase/acetolactate synthase (AHAS/ALS). In 2015, a suspected imazamox resistant biotype of Ae. cylindrica was found in eastern Washington. RESULTS Imazamox and mesosulfuron were applied to the suspected resistant and susceptible Ae. cylindrica biotypes in increasing application rates to evaluate herbicide dose needed to cause 50% growth reduction (GR50). The imazamox resistant biotype had a GR50 of 308.5 g ai ha−1 and was more than 5000 times more resistant to imazamox than a known susceptible biotype with a GR50 of 0.06 g ai ha−1. The Ae. cylindrica resistant biotype was also resistant to mesosulfuron, with an GR50 of 46.82 g ai ha−1, which was five times more than the susceptible GR50 of 8.6 g ai ha−1. Sequencing of the AHAS/ALS gene revealed an Ala122Thr substitution in the herbicide binding region of the AHAS/ALS gene on the D genome of Ae. cylindrica. The resistance trait was inherited as a dominant trait, and the Ala122Thr co‐segregates with the resistance phenotype. CONCLUSIONS An Ala122Thr substitution in the AHAS/ALS gene on the D genome of Ae. cylindrica confers resistance to imazamox in Ae. cylindrica. © 2021 Society of Chemical Industry.

show abstract

A mutation at the Ala122 position of acetohydroxyacid synthase (AHAS) located on chromosome 6D of wheat: improved resistance to imidazolinone and a faster assay for marker assisted selection

Cited by 20 publications

References 21 publications

Pollen‐Mediated Gene Flow in Commercial Fields of Spring Wheat in Western Canada

Pollen‐Mediated Gene Flow in Commercial Fields of Spring Wheat in Western Canada

Physiological, biochemical and molecular characterization of an induced mutation conferring imidazolinone resistance in wheat

An ALA₁₂₂THR substitution in the AHAS/ALS gene confers imazamox‐resistance in Aegilops cylindrica

Contact Info

Product

Resources

About

A mutation at the Ala122 position of acetohydroxyacid synthase (AHAS) located on chromosome 6D of wheat: improved resistance to imidazolinone and a faster assay for marker assisted selection

Cited by 20 publications

References 21 publications

Pollen‐Mediated Gene Flow in Commercial Fields of Spring Wheat in Western Canada

Pollen‐Mediated Gene Flow in Commercial Fields of Spring Wheat in Western Canada

Physiological, biochemical and molecular characterization of an induced mutation conferring imidazolinone resistance in wheat

An ALA122THR substitution in the AHAS/ALS gene confers imazamox‐resistance in Aegilops cylindrica

Contact Info

Product

Resources

About

An ALA₁₂₂THR substitution in the AHAS/ALS gene confers imazamox‐resistance in Aegilops cylindrica