A multi-Fc-species system for recombinant antibody production

Moutel, Sandrine; Marjou, Ahmed El; Vielemeyer, Ole; Nizak, Clément; Benaroch, Philippe; Dübel, Stefan; Perez, Franck

doi:10.1186/1472-6750-9-14

Cited by 50 publications

(44 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Because the Fc portion to which a given scFv would be fused can be chosen freely, various versions of the antibody, with the same variable regions but differing Fc fragments (mouse, rabbit, human, etc. ), can be produced, as recently described by our laboratory (18). Finally, additional modifications, including fusions to fluorescent tags, can be easily made.…”

Section: Discussionmentioning

confidence: 99%

Direct Selection of Monoclonal Phosphospecific Antibodies without Prior Phosphoamino Acid Mapping

Vielemeyer

Yuan

Moutel

et al. 2009

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

In the current post-genomic era, large scale efforts are underway to functionally explore the proteome by assembling large antibody libraries. However, because many proteins are modified post-translationally to regulate their function, collections of modification-specific sensors are also needed. Here we applied a novel approach to select monoclonal phosphospecific antibodies directly from the full-length protein and without upfront phosphoamino acid identification. We chose as antigen GRASP65, a well studied Golgi phosphoprotein. Bacterially produced full-length protein was first incubated with mitotic cytosol, thus allowing modification by naturally occurring kinases, and then used directly for affinity-based antibody selection using a single chain variable fragment phagemid library. In less than 1 week, three distinct and highly functional monoclonal phosphospecific antibodies against two GRASP65 epitopes were obtained and subsequently characterized. The presented approach is carried out fully in vitro, requires no prior knowledge of the phosphoamino acid identity, and is fast and inexpensive. It therefore has great potential to be an attractive alternative to classic animalbased protocols for the selection of post-translation modification sensors and thus to become an invaluable tool in our quest to understand the proteome in all its complexity.In the current post-genomic era, large scale efforts are underway to study the emerging proteome. Because of their ability to bind their respective targets with extremely high specificity, antibodies are essential tools in this endeavor. In fact, nonprofit organizations like the European "ProteomeBinders" Consortium (1) and the "Clinical Proteomic Technologies for Cancer" network (2) as well as commercial enterprises are currently sponsoring large projects to assemble all-inclusive antibody libraries.To regulate their function, many proteins are altered after their initial synthesis. Because such post-translational modifications change the physicochemical properties of a given protein, this further increases the complexity of the proteome. Therefore, the true challenge is to have not only all-inclusive antibody libraries but also to assemble collections of sensors, which specifically detect post-translational changes.One of the best studied modifications after polypeptide synthesis is reversible protein phosphorylation through the action of specific kinases and phosphatases. A plethora of cellular processes hinges upon the correct phosphorylation state of key regulators (3), and errors may result in cell death or malignancy (4). It is therefore not surprising that protein phosphorylation represents a very active area of research in the quest for new therapeutic cancer targets (5). Phosphospecific antibodies, first described over 25 years ago (6 -8), represent key tools in the study of cellular processes regulated by phosphorylation. Their production, however, is relatively costly and time consuming.In our laboratory we have succeeded in obtaining highly functional, co...

show abstract

Section: Discussionmentioning

confidence: 99%

Direct Selection of Monoclonal Phosphospecific Antibodies without Prior Phosphoamino Acid Mapping

Vielemeyer

Yuan

Moutel

et al. 2009

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…The staining pattern observed was specific and according to what has already been described for tubulin and myosin stainings. 29 Electroporation seems to have delivered enough antibody molecules to coat the cytoplasmic fiber networks in the living cell. None of the profection reagents was able to deliver this result (data not shown).…”

Section: Scfv-fc Antibodies Bind To Their Intracellular Antigen Aftermentioning

confidence: 99%

Delivery of antibodies to the cytosol

Marschall

Zhang

Frenzel

et al. 2014

mAbs

Self Cite

101

View full text Add to dashboard Cite

“…The rabbit Fc fragment of the pFUSE-rFc2-adapt-scFv vector [39] was amplified by PCR using forward primer GAGGCGGCCGCTAGATCTAGCAAGCCCA CGTG and backward primer GAGATTGGATCCATC ATGTCTGGCCAGCTAGC. The PCR product was purified by agarose gel electrophoresis and sub-cloned into pET14b-hFc-multitag between NotI and BamHI.…”

Section: Methodsmentioning

confidence: 99%

Bacterial cytoplasm as an effective cell compartment for producing functional VHH-based affinity reagents and Camelidae IgG-like recombinant antibodies

et al. 2014

Self Cite

View full text Add to dashboard Cite

Background: The isolation of recombinant antibody fragments from displayed libraries represents a powerful alternative to the generation of IgGs using hybridoma technology. The selected antibody fragments can then be easily engineered into (multi)-tagged constructs of variable mass and complexity as well as reconstituted into Camelidae IgG-like molecules when expressed fused to Fc domains. Nevertheless, all antibody constructs depend on an oxidizing environment for correct folding and consequently still belong to the proteins difficult to express in bacteria. In such organisms they are mostly produced at low yields in the periplasmic space.

show abstract

A multi-Fc-species system for recombinant antibody production

Cited by 50 publications

References 15 publications

Direct Selection of Monoclonal Phosphospecific Antibodies without Prior Phosphoamino Acid Mapping

Direct Selection of Monoclonal Phosphospecific Antibodies without Prior Phosphoamino Acid Mapping

Delivery of antibodies to the cytosol

Bacterial cytoplasm as an effective cell compartment for producing functional VHH-based affinity reagents and Camelidae IgG-like recombinant antibodies

Contact Info

Product

Resources

About