A molecular phylogenetic study of armoured scale insects (Hemiptera: Diaspididae)

Abstract

Armoured scale insects are economically important parasites of woody plants and grasses. They are promising subjects for the evolutionary study of physiology (no complete gut), genetics (chimerism, paternal genome elimination, frequent parthenogenesis) and coevolution (with host plants, parasitoids, Septobasidium fungi, endosymbiotic bacteria). Little phylogenetic work has been accomplished with armoured scales, and uncertainty surrounds their classification. Here, we report the phylogenetic results of Bayesian and parsimony analyses of 705 base pairs of Elongation Factor 1a and 660 base pairs of 28S from eighty-nine species of armoured scale insects, representing forty-seven genera and five tribes in the subfamilies Diaspidinae and Aspidiotinae, together with two outgroups. 28S was aligned based on a secondary structural model. Our results broadly corroborate the major features of the existing classification, although we do not find perfect monophyly of any of the traditionally recognized subfamilies or tribes. The subfamily Aspidiotinae is paraphyletic with respect to the subfamily Diaspidinae. Diaspidinae consists of two main clades that only roughly correspond to the tribes Lepidosaphidini and Diaspidini. Diaspidini is nearly monophyletic, except that it includes a single aspidiotine species. Other members of the tribe Aspidiotini form a clade, except that the clade includes a single species of Leucaspidini and excludes Maskellia and Pseudaonidia. Our results weakly support the hypothesis that the most recent common ancestor of the Diaspididae had adult females that were permanently enclosed within the derm of the second instar (the pupillarial habit) and had diploid adult males that eliminated their paternal genomes during spermatogenesis (late paternal genome elimination).

Parasitoidism Rate and Life Table Parameters of Aphytis diaspidis (Howard) (Hymenoptera: Aphelinidae) and Hemiberlesia lataniae (Signoret) (Hemiptera: Diaspididae)

“…This technique is highly effective to correctly identify parasitoids and Diaspididae (Pinto et al, 2002;Morse and Normark, 2006). Complementary to this, applying predictive models through population growth simulation that considers abiotic mortality factors, alternative food consumption, and migrational or competitive shifts (Flores et al, 2001;Barron, 2007;Gutierrez et al, 2008) will allow to determine the most biologically adequate parasitoid on latania scale for subsequent massification and release in affected crops.…”

South African Cycads at Risk:Aulacaspis yasumatsui(Hemiptera: Coccoidea: Diaspididae) in South Africa

“…A maximum likelihood (ML) analysis was performed in PAUP4.0b10 (Swofford 2000) using random sequence addition and tree bisection-recognition (TBR) branch swapping. Sequences used in the ML analysis were obtained from GenBank as published by Morse & Normark (2006) and Andersen et al (2010). The scale insect species Chionaspis pinifoliae was used as the outgroup.…”

“…PCR amplification of a DNA fragment spanning the D2 and D3 expansion segments of the 28S, the Translation Elongation factor (TEF) 1a and a region of mitochondrial DNA encompassing the 3' portion of cytochrome oxidase I (COI), and the 5' portion of cytochrome oxidase II (COII), was performed using reagents provided by KAPA Taq PCR Kit (Kapa Biosystems, Cape Town, South Africa). PCR protocols reported by Morse & Normark (2006) and Provencher et al (2005) were used to amplify the 28S and EF1a, and COI-COII regions, respectively. In the PCR reactions, the 28S primer s3660 (GAGAGTTMAASAGTAC GTGAA-AC), from Morse & Normark (2006), was paired with the primer 28b (TCGGAAGGAACCA GCTACTA) from Whiting et al (1997) to partially amplify the 28S genomic region.…”

“…PCR protocols reported by Morse & Normark (2006) and Provencher et al (2005) were used to amplify the 28S and EF1a, and COI-COII regions, respectively. In the PCR reactions, the 28S primer s3660 (GAGAGTTMAASAGTAC GTGAA-AC), from Morse & Normark (2006), was paired with the primer 28b (TCGGAAGGAACCA GCTACTA) from Whiting et al (1997) to partially amplify the 28S genomic region. Primer EF-1a (GATGCTCCGGGACAYAGA) from Morse & Normark (2006) was paired with primer EF2 (ATGTGAGCGGTGTGGCAATCCAA) from Palumbi (1996) for the TEF region.…”

“…In the PCR reactions, the 28S primer s3660 (GAGAGTTMAASAGTAC GTGAA-AC), from Morse & Normark (2006), was paired with the primer 28b (TCGGAAGGAACCA GCTACTA) from Whiting et al (1997) to partially amplify the 28S genomic region. Primer EF-1a (GATGCTCCGGGACAYAGA) from Morse & Normark (2006) was paired with primer EF2 (ATGTGAGCGGTGTGGCAATCCAA) from Palumbi (1996) for the TEF region. Primer C1-J2753ywr (GTAAACCTAACATTTTTYCCWCA RCA) from Provencher et al (2005) was paired with primer C2-N-3662, from Simon et al (1994), for the COI-COII region.…”