A Molecular Mechanism for Turning off IRE1α Signaling During Endoplasmic Reticulum Stress

Abstract

20unfolded proteins in the lumen of the endoplasmic reticulum (ER) and propagates the signal to 46 the cytosol. We have previously shown that IRE1α forms a complex with the Sec61 translocon 47 to cleave its substrate mRNAs (Plumb et al., 2015). This complex also regulates IRE1α 48 activation dynamics during ER stress in cells (Sundaram et al., 2017), but the underlying 49 mechanism is unclear. Here, we show that Sec63 is a subunit of the IRE1α/Sec61 translocon 50 complex. Sec63 recruits and activates BiP ATPase through its luminal J-domain to bind onto 51 IRE1α. This Sec63-mediated BiP binding to IRE1α suppresses the formation of higher-order 52 oligomers of IRE1α, leading to proper attenuation of IRE1α RNase activity during persistent ER 53 stress. Thus, our data suggest that the Sec61 translocon bridges IRE1α with Sec63/BiP to 54 regulate the dynamics of IRE1α activity in cells.

Signal sequences encode information for protein folding in the endoplasmic reticulum

“…HEK293-Flp-In T-Rex cells (Invitrogen, HeLa-Flp-In T-Rex cells and U2OS cells (a kind gift from Dr. Christian Schlieker, Yale University) were cultured in high glucose DMEM containing 10% FBS at 5% CO2. The knockout cell lines of Sec63 (Sun and Mariappan, 2019) or Sec62 were previously described (Li et al, 2020). The following Sec61a gRNA sequence: 5' AAAGCGAGGTTGGCAGCATGGGG 3' was cloned into the gRNA expression vector (Mali et al, 2013).…”