A MAR‐like antibody in a DC<sup>W</sup>e/DC<sup>W</sup>e person

O’Shea, K.; Øyen, Ragnhild; Sausais, Laima; Stephens, Vivian A.; Stillwell, Gail F.; Bisgard, Leslie A.; Martin, Judy; Reid, Marion E.

doi:10.1046/j.1537-2995.2001.41010053.x

Cited by 6 publications

(2 citation statements)

References 2 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1) [9]. C w -positive donors were genotyped for the C w allele (RHCE*02.08) in order to identify RHCE*02.08 homozygous individuals who are negative for the MAR (RH51) antigen [10]. For that purpose a specific TaqMan™ PCR assay with primers (forward: TTTTTACCCACTATGACGCTTCCTT; reverse: CTGTTCCAATGAACTCTCACCTTGA) and fluorescently labeled minor groove binding probes (for C w : FAM-CCCTTTCGATCCTC; for non-C w : VIC-CCCCTTTTGATCCTC) was used according to the standard protocol of the manufacturer (Life Technologies, Darmstadt, Germany).…”

Section: Methodsmentioning

confidence: 99%

The Impact of Using Genotyped Reagent Red Blood Cells in Antibody Identification

Scharberg

Rink

Portegys

et al. 2018

Transfus Med Hemother

View full text Add to dashboard Cite

Background: The detection and identification of antibodies to red blood cell (RBC) antigens is one of the most important and challenging issues in transfusion medicine. Up to date there are 354 RBC antigens recognized by the International Society of Blood Transfusion (ISBT). The reagent RBCs used in commercial antibody screening and identification panels however are usually serologically typed for up to 40 clinically important antigens. Thus the identification of many antibody specificities remains impossible when using reagent RBCs with only limited information about their antigens. To improve the pre-transfusion diagnostics, we developed antibody identification panels with reagent RBCs serologically typed for 26 antigens and additionally genotyped for 30 blood group alleles. Methods: The reagent RBCs in the panels were characterized serologically for the clinically most significant ‘standard' antigens. The reagent RBC donors were additionally genotyped by using in-house PCR-SSP methods. The antibody identification was performed in the indirect antiglobulin test using untreated and papain-treated RBCs in the gel technique. Antibodies identified due to the genotype information were confirmed by serology using appropriate reference RBCs. Results: Within a time period of 3 years and 8 months, 16,878 blood samples from 8,467 patients were tested in our reference laboratory. In total, 21 different antibodies from 10 different blood group systems could be identified in 126 patients (1.5%) due to the genotype information obtained for the reagent RBCs. Antibodies to antigens from the Knops system (53 patients; 42%, 8 patients with anti-Kn^b) and to Cartwright antigens (31 patients; 25%) were the most frequent. Conclusion: The use of genotyped reagent RBCs in antibody identification panels extends the range of detectable antibody specificities, accelerates the antibody identification, and improves the pre-transfusion diagnostics.

show abstract

Section: Methodsmentioning

confidence: 99%

The Impact of Using Genotyped Reagent Red Blood Cells in Antibody Identification

Scharberg

Rink

Portegys

et al. 2018

Transfus Med Hemother

View full text Add to dashboard Cite

show abstract

“…Two other antibodies to high frequency antigens, produced in probable RHCE * C x /C x [406] and RHCE * C w /C w [409] women, resembled anti -MAR in their serological reactions. However, the antibody from the RHCE * C w homozygote reacted weakly with DCC x e/DCC x e cells and the antibody from the RHCE * C x homozygote reacted strongly with DCC w e/DCC w e cells.…”

Section: Mar ( Rh51)mentioning

confidence: 99%