A Mammary Cell-Specific Enhancer in Mouse Mammary Tumor Virus DNA Is Composed of Multiple Regulatory Elements Including Binding Sites for CTF/NFI and a Novel Transcription Factor, Mammary Cell-Activating Factor

Abstract

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites.

Gene delivery available in molluscan cells by strong promoter discovered from bivalve-infectious virus

“…The topology of oshv117 TATA box, CCAAT box, and the transcription initiation site conforms to commonly observed patterns in eukaryotes ( 41 ). In addition, we found putative binding sites to transcription factors in mammals (HIF-1, DHFR, and MAF) and yeasts (RAP1) ( 37 – 40 ), which together might explain the OsHV-1 promoter activity in nonmolluscan cells.…”

“…NSite is a consensus-based search tool for putative functional motifs. The following is the binding motifs proposed by NSite within the OsHV-1 promoter for known regulatory elements, in which lower letters indicate mismatches with the consensus sequence: TACGTGGG, a conserved sequence that binds to mammalian hypoxia-inducible factor 1 (HIF-1) ( Homo sapiens , Mus musculus , Rattus norvegicus ) ( 37 ); GGATTGGC, a putative binding site of mammalian dihydrofolate reductase (DHFR) ( M. musculus ) ( 38 ); GAGGGAagGT, a putative binding site of mammalian mammary cell–activating factor (MAF) ( H. sapiens and M. musculus ) ( 39 ); and ACACCatTACATT, near the TATA box for oshv117 , a RPG box-like sequence that putatively binds to Ras-associated protein 1 (RAP1) of Saccharomyces cerevisiae ( 40 ). The CAATT box consensus sequence (T/C)GATTGG(T/C)(T/C)(G/A) ( 41 ) was found at the position −91 5′ upstream from the oshv117 transcription initiation site.…”

A Mutant Androgen Receptor from Patients with Reifenstein Syndrome: Identification of the Function of a Conserved Alanine Residue in the D Box of Steroid Receptors

“…Whole cell extracts were prepared as described by Eul et al (12) except that the buffers used contained the following protease inhibitors: 1 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine, 0.6 ,ug of aprotinin per ml, 1 pLg of pepstatin per ml, 1 ,ug of leupeptin per ml, and 1 ,g of antipain per ml. Gel retardation studies were carried out as previously described (27). The oligonucleotide used for the gel retardation studies was obtained by annealing the singlestranded oligonucleotides 5'AGCTlAGAACACAGTGTTC TCTAGAG3' and 5'GATCCTCTAGAGAACACTGTGTT CTA3'.…”

NF1/X represses PDGF A-chain transcription by interacting with Sp1 and antagonizing Sp1 occupancy of the promoter

“…NF1 represents a family of transcription factors that regulate the expression of a diverse range of cellular (Cereghini et al ., 1987) and viral (Plumb et al ., 1991; Mink et al ., 1992; Kumar et al ., 1993) genes. NF1 proteins were first cloned from human HeLa cells (Santoro et al ., 1988) and subsequently isolated from hamster (Gil et al ., 1988), rat (Paonessa et al ., 1988), pig (Meisterernst et al ., 1989) and chicken (Rupp et al ., 1990).…”