A M35 family metalloprotease is required for fungal virulence against insects by inactivating host prophenoloxidases and beyond

Huang, Antian; Lu, Mengting; Ling, Erjun; Li, Ping; Wang, Chengshu

doi:10.1080/21505594.2020.1731126

Cited by 39 publications

(35 citation statements)

References 68 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To determine the function of MrHex1 , targeted deletion was performed by homologous recombination via the Agrobacterium -mediated transformation of the WT strain of M. robertsii as described before [ 26 ]. In brief, the 5′- and 3′- flanking sequences were amplified using the genomic DNA as a template with the primer pairs hex1UF (CGGAATTCGTACGGACCGATAAAACGTG) and hex1UR (CGGAATTCGAATGTCCTCCTTGATGTC), hex1DF (GCTCTAGACTGTCGACTGC-TTTCGAGTC) and hex1DR (GCTCTAGATAAGACACCCCATGTCAGC), respectively.…”

Section: Methodsmentioning

confidence: 99%

“…For stress challenges, fungi were grown on PDA or PDA amended with the final concentrations of 0.01% sodium dodecyl sulphate (SDS), 200 μg/mL Calcofluor white and 250 μg/mL Congo red for cell wall integrity challenges; 50 μM farnesol for antifungal resistance, and 1.5 M KCl and 1 M Sorbitol for osmotic challenges [ 18 , 26 ], respectively. For inoculation, 2 μL of the 10-fold diluted spore suspensions (2 × 10 7 conidia/mL) were spotted onto the plates and incubated at 25 °C for three days.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

MrHex1 is Required for Woronin Body Formation, Fungal Development and Virulence in Metarhizium robertsii

Tang

Shang

et al. 2020

JoF

Self Cite

View full text Add to dashboard Cite

The Woronin body (WB) is a peroxisome-derived dense-core vesicle, a self-assembling hexagonal crystal of a single protein Hex1. This organelle is specific to the ascomycete fungi belonging to the Pezizomycotina subphylum by functioning in sealing septal pores in response to mycelium damage and the control of cell heterogeneity. We retrieved all available Hex1-domain containing proteins of different fungi from the GenBank database and found considerable length variations among 460 obtained Hex1 proteins. However, a highly conserved Hex1 domain containing 75 amino acid residues with a specific S/A-R/S-L consensus motif for targeting peroxisome is present at the carboxy-terminus of each protein. A homologous Hex1 gene, named MrHex1, was deleted in the entomopathogenic fungus Metarhizium robertsii. It was found that MrHex1 was responsible for WB formation in M. robertsii and involved in sealing septal pores to maintain cell integrity and heterogeneity. Different assays indicated that, relative to the wild-type (WT) strain, ∆Mrhex1 demonstrated a growth defect on a solid medium and substantial reductions of conidiation, appressorium formation and topical infectivity against insect hosts. However, there was no obvious virulence difference between WT and mutants during injection of insects. We also found that ∆MrHex1 could tolerate different stress conditions like the WT and the gene-rescued mutant of M. robertsii, which is in contrast to the reports of the stress-response defects of the Hex1 null mutants of other fungal species. In addition to revealing the phenotypic/functional alterations of the Hex1 deletion mutants between different pathotype fungi, the results of this study may benefit the understanding of the evolution and WB-control of fungal entomopathogenicity.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

MrHex1 is Required for Woronin Body Formation, Fungal Development and Virulence in Metarhizium robertsii

Tang

Shang

et al. 2020

JoF

Self Cite

View full text Add to dashboard Cite

show abstract

“…1C ) to the BGC of emericellamides in A. nidulans ( 22 ). To determine the functions of the clustered genes, gene deletions were individually performed by Agrobacterium -mediated transformation of B. bassiana ( 39 ). To generate the deletion vectors, the 5′- and 3′-flanking regions of the target gene were amplified using different primer pairs (see Table S3 in the supplemental material).…”

Section: Methodsmentioning

confidence: 99%

“…To determine if there was any contribution of BVDs to fungal virulence against insects, the WT strains of B. bassiana (ARSEF 2860), B. brongniartii , and C. militaris were first examined using the female adults of Drosophila melanogaster by topical infection with spore suspensions (1 × 10 7 conidia/ml) ( 39 ). After verification that C. militaris was nonvirulent to fruit flies, the WT strains of B. bassiana and B. brongniartii and besB and BrbesB deletion mutants were then assayed in parallel against the fruit flies and the last instar larvae of the wax moth G. mellonella as described before ( 40 ).…”

Section: Methodsmentioning

confidence: 99%

Production of Diverse Beauveriolide Analogs in Closely Related Fungi: a Rare Case of Fungal Chemodiversity

Yin

Chen

Song

et al. 2020

mSphere

Self Cite

View full text Add to dashboard Cite

Fungal chemodiversity is well known in part due to the production of diverse analogous compounds by a single biosynthetic gene cluster (BGC). Usually, similar or the same metabolites are produced by closely related fungal species under a given condition, the foundation of fungal chemotaxonomy. Here, we report a rare case of the production of the cyclodepsipeptide beauveriolides (BVDs) in three insect-pathogenic fungi. We found that the more closely related fungi Beauveria bassiana and Beauveria brongniartii produced structurally distinct analogs of BVDs, whereas the less-close relatives B. brongniartii and Cordyceps militaris biosynthesized structurally similar congeners under the same growth condition. It was verified that a conserved BGC containing four genes is responsible for BVD biosynthesis in three fungi, including a polyketide synthase (PKS) for the production of 3-hydroxy fatty acids (FAs) with chain length variations. In contrast to BVD production patterns, phylogenetic analysis of the BGC enzymes or enzyme domains largely resulted in the congruence relationship with fungal speciation. Feeding assays demonstrated that an FA with a chain length of eight carbon atoms was preferentially utilized, whereas an FA with a chain longer than 10 carbon atoms could not be used as a substrate for BVD biosynthesis. Insect survival assays suggested that the contribution of BVDs to fungal virulence might be associated with the susceptibility of insect species. The results of this study enrich the knowledge of fungal secondary metabolic diversity that can question the reliability of fungal chemotaxonomy. IMPORTANCE Fungal chemotaxonomy is an approach to classify fungi based on the fungal production profile of metabolites, especially the secondary metabolites. We found an atypical example that could question the reliability of fungal chemical classifications in this study, i.e., the more closely related entomopathogenic species Beauveria bassiana and Beauveria brongniartii produced structurally different congeners of the cyclodepsipeptide beauveriolides, whereas the rather divergent species B. brongniartii and Cordyceps militaris biosynthesized similar analogs under the same growth condition. The conserved biosynthetic gene cluster (BGC) containing four genes present in each species is responsible for beauveriolide production. In contrast to the compound formation profiles, the phylogenies of biosynthetic enzymes or enzymatic domains show associations with fungal speciation. Dependent on the insect species, production of beauveriolides may contribute to fungal virulence against the susceptible insect hosts. The findings in this study augment the diversity of fungal secondary metabolisms.

show abstract

“…Relative to the ∆CmbesB sample, additional peak(s) Insect bioassays. To determine if any contribution of BVDs to fungal virulence against insects, the WT strains of B. bassiana, B. brongniartii and C. militaris were first examined using the female adults of Drosophila melanogaster by topical infection with spore suspensions (1  10 7 conidia/ml) (45). After verification that C. militaris was non-virulent to fruit flies, the WT strains of B. bassiana and B. brongniartii, and besB and BrbesB deletion mutants were then assayed in parallel against the fruit flies and the last instar larvae of the wax moth G. mellonella as being described before (37).…”

Section: Substrate Feeding Assaysmentioning

confidence: 99%

Production of diverse beauveriolide analogs in closely related fungi: a rare case of fungal chemodiversity

Yin

Chen

Song

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

ABSTRACTFungal chemodiversity is well known in part due to the production of diverse analogous compounds by a single biosynthetic gene cluster (BGCs). Usually, similar metabolites are produced by closely related fungal species. Here we report a rare case of the production of the cyclodepsipeptide beauveriolides (BVDs) in three insect pathogenic fungi. We found that the more closely-related fungi Beauveria bassiana and B. brongniartii produce structurally distinct analogs of BVDs whereas the rather divergently evolved species B. brongniartii and Cordyceps militaris produce structural analogs in a similar pattern. It was verified that a conserved BGC containing four genes is responsible for BVD biosynthesis in three fungi including a polyketide synthase (PKS) for the production of 3-hydroxy fatty acids (FAs) with chain length variations. In contrast to BVD production patterns, phylogenetic analysis of the BGC enzymes or enzyme domains largely resulted in the congruence relationship with fungal speciation. Feeding assays demonstrated that a FA with a chain length of eight carbon atoms was preferentially utilized whereas a FA with a chain longer than 10 carbon atoms could not be used as a substrate for BVD biosynthesis. We also found that addition of D-type amino acids could not enable B. bassiana to produce those analogs biosynthesized by other two fungi. Insect survival assays suggested that the contribution of BVD to fungal virulence might be associated with the susceptibility of insect species. The results of this study enrich the knowledge of fungal secondary metabolic diversity.IMPORTANCEFungal chemotaxonomy is an approach to classify fungi based on fungal production of natural compounds especially the secondary metabolites. We found an atypical example that could question chemical classification of fungi in this study: the more closely-related entomopathogenic species Beauveria bassiana and B. brongniartii produce structurally different analogs of the cyclodepsipeptide beauveriolides whereas the rather divergent species B. brongniartii and Cordyceps militaris biosynthesize similar analogs under the same growth condition. The conserved BGC containing four genes is present in each species and responsible for beauveriolide production. In contrast to the compound formation profiles, the phylogenies of biosynthetic enzymes or enzymatic domains show associations with fungal speciation relationship. Dependent on insect species, production of beauveriolides may contribute to fungal virulence against insect. The findings in this study augment the diversity of fungal secondary metabolisms.

show abstract

A M35 family metalloprotease is required for fungal virulence against insects by inactivating host prophenoloxidases and beyond

Cited by 39 publications

References 68 publications

MrHex1 is Required for Woronin Body Formation, Fungal Development and Virulence in Metarhizium robertsii

MrHex1 is Required for Woronin Body Formation, Fungal Development and Virulence in Metarhizium robertsii

Production of Diverse Beauveriolide Analogs in Closely Related Fungi: a Rare Case of Fungal Chemodiversity

Production of diverse beauveriolide analogs in closely related fungi: a rare case of fungal chemodiversity

Contact Info

Product

Resources

About