A rhlI 5′ UTR-Derived sRNA Regulates RhlR-Dependent Quorum Sensing in Pseudomonas aeruginosa

Abstract

N-Acyl homoserine lactone (AHL) quorum sensing (QS) controls expression of over 200 genes in Pseudomonas aeruginosa. There are two AHL regulatory systems: the LasR-LasI circuit and the RhlR-RhlI system. We mapped transcription termination sites affected by AHL QS in P. aeruginosa, and in doing so we identified AHL-regulated small RNAs (sRNAs). Of interest, we noted that one particular sRNA was located within the rhlI locus. We found that rhlI, which encodes the enzyme that produces the AHL N-butanoyl-homoserine lactone (C4-HSL), is controlled by a 5′ untranslated region (UTR)-derived sRNA we name RhlS. We also identified an antisense RNA encoded opposite the beginning of the rhlI open reading frame, which we name asRhlS. RhlS accumulates as wild-type cells enter stationary phase and is required for the production of normal levels of C4-HSL through activation of rhlI translation. RhlS also directly posttranscriptionally regulates at least one other unlinked gene, fpvA. The asRhlS appears to be expressed at maximal levels during logarithmic growth, and we suggest RhlS may act antagonistically to the asRhlS to regulate rhlI translation. The rhlI-encoded sRNAs represent a novel aspect of RNA-mediated tuning of P. aeruginosa QS. IMPORTANCE The opportunistic human pathogen Pseudomonas aeruginosa possesses multiple quorum sensing systems that regulate and coordinate production of virulence factors and adaptation to different environments. Despite extensive research, the regulatory elements that play a role in this complex network are still not fully understood. By using several RNA sequencing techniques, we were able to identify a small regulatory RNA we named RhlS. RhlS increases translation of RhlI, a key enzyme in the quorum sensing pathway, and represses the fpvA mRNA encoding one of the siderophore pyoverdine receptors. Our results highlight a new regulatory layer of P. aeruginosa quorum sensing and contribute to the growing understanding of the role regulatory RNAs play in bacterial physiology.

Intraspecies Signaling between Common Variants of Pseudomonas aeruginosa Increases Production of Quorum-Sensing-Controlled Virulence Factors

“…The temporal pattern of activation and the stimulation of RhlI-HA in the absence of RhlR control suggested that the RhlI protein may precede signal amplification via the QS transcriptional network. This would be consistent with a primary effect on posttranscriptional modulation of RhlI-mediated RhlR activity, as has been reported previously to occur through an RhlS small RNA (sRNA)-dependent mechanism ( 63 ); however, we found no apparent difference in RhlS expression levels in our RNA-seq reads in coculture. To begin to unravel the mechanisms by which citrate promoted RhlR/I-dependent signaling and RhlI stability in ∆ lasR cells, we analyzed the role of two proteases previously found to target and degrade RhlI (i.e., Lon and ClpXP) ( 64 ).…”

Introducing differential RNA-seq mapping to track the early infection phase forPseudomonasphage ɸKZ

“…We also predicted a total of 55 proteins to be synthesized from leaderless mRNAs (pTSS <10 bp of the start codon), which may require a distinct type of translation initiation [32]. P. aeruginosa is rife with sRNAs, many of which associate with the sRNA chaperone Hfq [33,34] and act by base-paring mechanisms to either repress or activate the translation of trans-encoded target mRNAs [35][36][37][38]. Although many more have been predicted [39], PseudoCAP [17] currently lists only 43 ncRNAs for this strain, most of which were expressed during late exponential/stationary phase [40].…”

Quantitative mapping of mRNA 3’ ends in Pseudomonas aeruginosa reveals a pervasive role for premature 3’ end formation in response to azithromycin

“…These premature termination candidates include genes previously reported to be controlled by transcription termination in P. aeruginosa, such as the amiE operon ( Figure 2B), rhlA, and rhlI (Supplementary Figure 3C) [73][74][75]. The gene with highest early transcription termination is rhlI, from whose transcript leader the sRNA rhlS was recently reported to be derived [76]. Genes known to be regulated by transcription attenuation in other bacteria, but not in P. aeruginosa, such as pyrG (Supplementary Figure 3D), trpGCD ( Supplementary Figures 3E-3F), rplJ, and lysR family transcriptional regulators (PA14_68920 and PA14_71750) were also predicted to be regulated by early transcription termination [10,13,77,78].…”

“…ATGTGTGTGCTGGTATGTCCTCCGACTGAGAGGGCCCAGG AGTATCAGGGTAGGGATGCCGCCTTTTTTTT*CTCGGCCGG CACGACACGGGGACTTGGTCA*TGATCGAATTGCTCTCTGA ATCGCTGGAAGGGCTTTCCG*CC Note: Alternate structure predicted with full ET sequence. Regulation by transcription attenuation [76].…”