A Hypermorphic <i>Nfkbid</i> Allele Contributes to Impaired Thymic Deletion of Autoreactive Diabetogenic CD8+ T Cells in NOD Mice

Presa, Maximiliano; Racine, Jeremy J.; Dwyer, Jennifer R.; Lamont, Deanna J.; Ratiu, Jeremy; Sarsani, Vishal Kumar; Chen, Yi-Guang; Geurts, Aron M.; Schmitz, Ingo; Stearns, Timothy M.; Allocco, Jennifer; Chapman, Harold D.; Serreze, David

doi:10.4049/jimmunol.1800465

Cited by 15 publications

(12 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…IBNS belongs to the nuclear IB-like family of proteins and is classified as an inhibitor of NF-B (22). The dysfunctionality of IBNS in bumble mice could potentially result in elevated cell-mediated and humoral immune responses against FrMLV (20,(23)(24)(25)(26). We tested a possible role for CD8 ϩ T cells by depleting them in B6 and bumble mice using antibodies against CD8␣.…”

Section: Resultsmentioning

confidence: 99%

Murine Leukemia Virus Exploits Innate Sensing by Toll-Like Receptor 7 in B-1 Cells To Establish Infection and Locally Spread in Mice

Iwasaki

Sewald

et al. 2019

J Virol

View full text Add to dashboard Cite

Lymph-borne Friend murine leukemia virus (FrMLV) exploits the sentinel macrophages in the draining popliteal lymph node (pLN) to infect highly permissive innate-like B-1 cells and establish infection in mice. The reason for FrMLV sensitivity of B-1 cells and their impact on viral spread is unknown. Here we demonstrate that Toll-like receptor 7 (TLR7) sensing and type I interferon (IFN-I) signaling in B-1 cells contribute to FrMLV susceptibility. FrMLV infection in B-1 cell-deficient mice (bumble; IκBNS dysfunctional) was significantly lower than that in the wild-type mice and was rescued by adoptive transfer of wild-type B-1 cells. This rescue of FrMLV infection in bumble mice was dependent on intact TLR7 sensing and IFN-I signaling within B-1 cells. Analyses of infected cell types revealed that the reduced infection in bumble mice was due predominantly to compromised virus spread to the B-2 cell population. Our data reveal how FrMLV exploits innate immune sensing and activation in the B-1 cell population for infection and subsequent spread to other lymphocytes. IMPORTANCE Viruses establish infection in hosts by targeting highly permissive cell types. The retrovirus Friend murine leukemia virus (FrMLV) infects a subtype of B cells called B-1 cells that permit robust virus replication. The reason for their susceptibility had remained unknown. We found that innate sensing of incoming virus and the ensuing type I interferon response within B-1 cells are responsible for their observed susceptibility. Our data provide insights into how retroviruses coevolved with the host to co-opt innate immune sensing pathways designed to fight virus infections for establishing infection. Understanding early events in viral spread can inform antiviral intervention strategies that prevent the colonization of a host.

show abstract

Section: Resultsmentioning

confidence: 99%

Murine Leukemia Virus Exploits Innate Sensing by Toll-Like Receptor 7 in B-1 Cells To Establish Infection and Locally Spread in Mice

Iwasaki

Sewald

et al. 2019

J Virol

View full text Add to dashboard Cite

show abstract

“…A large amount of literature has documented the importance of CD8 T cells in T1D pathogenesis over the last three decades (29–31). The current consensus is that CD8 T cells are the ultimate mediator of beta cell destruction (32), most likely via perforin and Fas mediated pathways (33, 34). Of particular note is the critical role of EM CD8 T cells in the final phase of beta cell destruction; T EM CD8 cells are now well-recognized as a prime target for emergent T1D therapies (35, 36).…”

Section: Discussionmentioning

confidence: 99%

Soluble CD137 Ameliorates Acute Type 1 Diabetes by Inducing T Cell Anergy

et al. 2019

Self Cite

View full text Add to dashboard Cite

We show here that soluble CD137 (sCD137), the alternately spliced gene product of Tnfsfr9, effectively treats acute type 1 diabetes (T1D) in nonobese diabetic (NOD) mice. sCD137 significantly delayed development of end-stage disease, preserved insulin+ islet beta cells, and prevented progression to end-stage T1D in some mice. We demonstrate that sCD137 induces CD4+ T cell anergy, suppressing antigen-specific T cell proliferation and IL-2/IFN-γ secretion. Exogenous IL-2 reversed the sCD137 anergy effect. sCD137 greatly reduces inflammatory cytokine production by CD8 effector memory T cells, critical mediators of beta cell damage. We demonstrate that human T1D patients have decreased serum sCD137 compared to age-matched controls (as do NOD mice compared to NOD congenic mice expressing a protective Tnfsfr9 allele), that human sCD137 is secreted by regulatory T cells (Tregs; as in mice), and that human sCD137 induces T cell suppression in human T cells. These findings provide a rationale for further investigation of sCD137 as a treatment for T1D and other T cell–mediated autoimmune diseases.

show abstract

“…Dr. Qizhi Tang provided the NOD.CD2-dsRed mice. NOD.CXCR6 −/− were generated by Dr. David Serreze at The Jackson Laboratory as previously described by CRISPR/Cas9 targeting of exon 2 of CXCR6 in NOD mice using the guide sequence CTCTTGATGCCCATCATCCA, resulting in a 7 base pair deletion (83). NOD.CXCR6 −/− were provided by Dr. Yi-Guang Chen, and are now available from The Jackson Laboratory (033094).…”

Section: Methodsmentioning

confidence: 99%

CD11c+ Cells Are Gatekeepers for Lymphocyte Trafficking to Infiltrated Islets During Type 1 Diabetes

et al. 2019

Self Cite

View full text Add to dashboard Cite

Type 1 diabetes (T1D) is a T cell mediated autoimmune disease that affects more than 19 million people with incidence increasing rapidly worldwide. For T cells to effectively drive T1D, they must first traffic to the islets and extravasate through the islet vasculature. Understanding the cues that lead to T cell entry into inflamed islets is important because diagnosed T1D patients already have established immune infiltration of their islets. Here we show that CD11c+ cells are a key mediator of T cell trafficking to infiltrated islets in non-obese diabetic (NOD) mice. Using intravital 2-photon islet imaging we show that T cell extravasation into the islets is an extended process, with T cells arresting in the islet vasculature in close proximity to perivascular CD11c+ cells. Antigen is not required for T cell trafficking to infiltrated islets, but T cell chemokine receptor signaling is necessary. Using RNAseq, we show that islet CD11c+ cells express over 20 different chemokines that bind chemokine receptors expressed on islet T cells. One highly expressed chemokine-receptor pair is CXCL16-CXCR6. However, NOD. CXCR6−/− mice progressed normally to T1D and CXCR6 deficient T cells trafficked normally to the islets. Even with CXCR3 and CXCR6 dual deficiency, T cells trafficked to infiltrated islets. These data reinforce that chemokine receptor signaling is highly redundant for T cell trafficking to inflamed islets. Importantly, depletion of CD11c+ cells strongly inhibited T cell trafficking to infiltrated islets of NOD mice. We suggest that targeted depletion of CD11c+ cells associated with the islet vasculature may yield a therapeutic target to inhibit T cell trafficking to inflamed islets to prevent progression of T1D.

show abstract

A Hypermorphic Nfkbid Allele Contributes to Impaired Thymic Deletion of Autoreactive Diabetogenic CD8+ T Cells in NOD Mice

Cited by 15 publications

References 45 publications

Murine Leukemia Virus Exploits Innate Sensing by Toll-Like Receptor 7 in B-1 Cells To Establish Infection and Locally Spread in Mice

Murine Leukemia Virus Exploits Innate Sensing by Toll-Like Receptor 7 in B-1 Cells To Establish Infection and Locally Spread in Mice

Soluble CD137 Ameliorates Acute Type 1 Diabetes by Inducing T Cell Anergy

CD11c+ Cells Are Gatekeepers for Lymphocyte Trafficking to Infiltrated Islets During Type 1 Diabetes

Contact Info

Product

Resources

About