A Human Mitochondrial DNA Standard Reference Material for Quality Control in Forensic Identification, Medical Diagnosis, and Mutation Detection

Levin, Barbara C.; Cheng, Haiyan; Reeder, Dennis J.

doi:10.1006/geno.1998.5513

Cited by 97 publications

(72 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Standard errors were estimated from 1000 (H) 133 100 50 100 50 100 31 100 165 100 50 100 50 100 1 this study 2 data from Loogväli et al (2004) Note -The fraction of unclassified hg H haplotypes involving haplogroups H8, H9, H10, H12, H13, H14 and H15 (Achilli et al 2004;Loogväli et al 2004), based on the data taken from literature (32 from 458 Achilli et al 2004;Coble et al 2004;Finnilä et al 2001;Herrnstadt et al 2002;Howell et al 2003;Ingman et al 2000;Levin et al 1999;Maca-Meyer et al 2001;Mishmar et al 2003;Palanichamy et al 2004;Reid et al 1994;Rieder et al 1998) makes up only 5-10% of hg H, thus ca. 9 out of 133 in our sample.…”

Section: Discussionmentioning

confidence: 99%

Mitochondrial DNA Portrait of Latvians: Towards the Understanding of the Genetic Structure of Baltic‐Speaking Populations

Pliss

Tambets

Loogväli

et al. 2006

Annals of Human Genetics

View full text Add to dashboard Cite

SummaryMitochondrial DNA (mtDNA) variation was investigated in a sample of 299 Latvians, a Baltic-speaking population from Eastern Europe. Sequencing of the first hypervariable segment (HVS-I) in combination with analysis of informative coding region markers revealed that the vast majority of observed mtDNAs belong to haplogroups (hgs) common to most European populations. Analysis of the spatial distribution of mtDNA haplotypes found in Latvians, as well as in Baltic-speaking populations in general, revealed that they share haplotypes with all neighbouring populations irrespective of their linguistic affiliation. Hence, the results of our mtDNA analysis show that the previously described sharp difference between the Y-chromosomal hg N3 distribution in the paternally inherited gene pool of Baltic-speaking populations and of other European Indo-European speakers does not have a corresponding maternal counterpart.

show abstract

Section: Discussionmentioning

confidence: 99%

Mitochondrial DNA Portrait of Latvians: Towards the Understanding of the Genetic Structure of Baltic‐Speaking Populations

Pliss

Tambets

Loogväli

et al. 2006

Annals of Human Genetics

View full text Add to dashboard Cite

show abstract

“…7,8 Briefly, amplifications were performed in 50 ml reactions comprising of approximately 50 ng DNA, 0.1 mM dNTPs (Roche, Indianapolis, IN, USA), 1 Â PCR Gold buffer, 1.5 mM MgCl 2 , 0.5 mM each primer, 2.5 U AmpliTaq Gold polymerase (Applied Biosystems, Foster City, CA, USA), and nuclease-free H 2 O (Promega, Madison, WI, USA). Primer sequences were as follows: 5 0 CACCCTATTAACCACTCACG3 0 sense and 5 0 TGAGATTA GTAGTATGGGAG3 0 antisense for D loop (#15-484), 7 5 0 AACATACCCATGGCCAACCT3 0 sense and 5 0 GGCAGGA GTAATCAGAGGTG3 0 antisense for NDI (#3304-3836), 8 5 0 TATCACCTTTCATGATACGC3 0 sense and 5 0 GACGAT GGGCATGAAACTG3 0 antisense for COXII (#7645-8215), 5 0 CTGTTCGCTTCATTCATTGCC3 0 sense and 5 0 GTGGCGCT TCCAATTAGGTG3 0 antisense for ATPase 6 (#8539-9059), gel at 100 V for 45 min to confim product purity and correct size. The remaining portion of the PCR product was column purified using a Qiaquick PCR Purification Kit (Qiagen, Valencia, CA, USA).…”

Section: Polymerase Chain Reaction and Dna Sequencingmentioning

confidence: 99%

Mitochondrial DNA mutations in primary leukemia cells after chemotherapy: clinical significance and therapeutic implications

et al. 2003

View full text Add to dashboard Cite

Mitochondrial DNA (mtDNA) codes for 13 respiratory chain subunits and is more vulnerable to damage than nuclear DNA due, in part, to a lack of histone protection and a weak repair capacity. While mtDNA alterations have been observed in human cancer, their roles in oncogenesis and chemosensitivity remain unclear. We investigated the relationship between mtDNA mutations, reactive oxygen species (ROS) generation, and clinical outcomes in chronic lymphocytic leukemia (CLL) patients. An analysis of mtDNA from 20 CLL patients revealed that primary CLL cells from patients with prior chemotherapy had a significantly higher frequency of heteroplasmic mutations than did those from untreated patients. Overall, mtDNA mutations appeared to be associated with increased ROS generation. Patients refractory to conventional therapeutic agents tended to have higher mutation rates than patients who responded to treatment. Analysis of paired blood samples from the same patient led to the identification of a heteroplasmic mutation in the cytochrome c oxidase II gene several months after chemotherapy. The mutation was associated with increased ROS generation. Our results suggest for the first time that chemotherapy with DNA-damaging agents may cause mtDNA mutations in primary leukemia cells, which often exist in heteroplasmy, and are associated with increased ROS generation.

show abstract

“…Nucleotide positions 16 024 ± 16 324 and 63 ± 322 located in the D-Loop are termed ®rst hypervariable region (HV1) and second hypervariable region (HV2), respectively (Miller et al, 1996). The sequence analysis of these two regions is used not only in forensic analyses, but also in medical diagnosis (Levin et al, 1999). Fliss et al (2000) suggested that the constitutive hypervariable areas such as the mtDNA D-Loop are hot spots for somatic mutations in malignant tumors.…”

mentioning

confidence: 99%

Mutations in the mitochondrial DNA D-Loop region occur frequently in adenocarcinoma in Barrett's esophagus

et al. 2002

View full text Add to dashboard Cite

Mitochondrial DNA (mtDNA) is known for high mutation rates caused by lack of protective histones, ine cient DNA repair systems, and continuous exposure to mutagenic e ects of oxygen radicals. We examined the frequency of mutations in the mtDNA D-Loop region in 20 patients with Barrett's carcinoma and associated Barrett's epithelium by automated DNA sequencing. Mutations were detected in eight of 20 (40%) patients in tumor and/or tumor-associated Barrett's epithelium. In six of eight positive cases, the mutations were detected only in the tumor, one of eight showed mutations in tumor and Barrett's epithelium, and one of eight only in Barrett's epithelium. The degree of dysplasia in Barrett's epithelium was classi®ed low-grade in one and high grade in the two specimens. There was no association of mtDNA D-Loop mutations with histopathological stage of disease or tumor grading. We present the ®rst study of frequent occurrence of mutations in the mtDNA D-Loop regions in adenocarcinomas in Barrett's esophagus. Furthermore, this study supports the hypothesis that oxidative damage might be a mechanism for the induction of adenocarcinoma in Barrett's esophagus. Since mutations were identi®ed in tumor-associated dysplastic Barrett's epithelium, they also might become a marker for the malignant potential of Barrett's epithelium.

show abstract

A Human Mitochondrial DNA Standard Reference Material for Quality Control in Forensic Identification, Medical Diagnosis, and Mutation Detection

Cited by 97 publications

References 7 publications

Mitochondrial DNA Portrait of Latvians: Towards the Understanding of the Genetic Structure of Baltic‐Speaking Populations

Mitochondrial DNA Portrait of Latvians: Towards the Understanding of the Genetic Structure of Baltic‐Speaking Populations

Mitochondrial DNA mutations in primary leukemia cells after chemotherapy: clinical significance and therapeutic implications

Mutations in the mitochondrial DNA D-Loop region occur frequently in adenocarcinoma in Barrett's esophagus

Contact Info

Product

Resources

About