A homozygous R148W mutation in Semaphorin 7A causes progressive familial intrahepatic cholestasis

Abstract

Semaphorin 7A (SEMA7A) is a membrane-bound protein that involves axon growth and other biological processes. SEMA7A mutations are associated with vertebral fracture and Kallmann syndrome. Here, we report a case with a mutation in SEMA7A that displays familial cholestasis. WGS reveals a SEMA7A R148W homozygous mutation in a female child with elevated levels of serum ALT, AST, and total bile acid (TBA) of unknown etiology. This patient also carried a SLC10A1 S267F allele, but Slc10a1 S267F homozygous mice exhibited normal liver function. Similar to the child, Sema7a R145W homozygous mice displayed elevated levels of serum ALT, AST, and TBA. Remarkably, liver histology and LC-MS/MS analyses exhibited hepatocyte hydropic degeneration and increased liver bile acid (BA) levels in Sema7a R145W homozygous mice. Further mechanistic studies demonstrated that Sema7a R145W mutation reduced the expression of canalicular membrane BA transporters, bile salt export pump (Bsep), and multidrug resistance-associated protein-2 (Mrp2), causing intrahepatic cholestasis in mice. Administration with ursodeoxycholic acid and a dietary supplement glutathione improved liver function in the child. Therefore, Sema7a R145W homozygous mutation causes intrahepatic cholestasis by reducing hepatic Bsep and Mrp2 expression.

Biochemical and Bioinformatic Characterization of Patients with a Sodium Taurocholate Cotransporting Polypeptide Mutation

“…We noted that in some cases, SLC10A1 S267F homozygotes with a combination of other gene mutations or diseases showed different symptoms, such as jaundice and/or liver dysfunction, late fetal loss, or urticarial rashes (13,15,17,25,26). We confirmed that serum BA levels increased asymptotically in SLC10A1 S267F homozygotes.…”

“…Some studies have mentioned that patients with SLC10A1 S267F display worse clinical phenotype (such as liver dysfunction), always accompanied by other damage variants. Also, our previous results indicated that Slc10a1 S267F homozygous mice displayed normal levels of serum BA and did not cause hypercholanemia (26). Thus, to our knowledge, there are probably other variants in SLC10A1 S267F homozygotes; in this regard, 5 candidate SNPs are described below.…”

Semaphorin 7A interacts with nuclear factor NF-kappa-B p105 via integrin β1 and mediates inflammation

“…Homozygous Sema7a R145W mutant mice (C57BL/6 J background) were designed and generated by Shanghai Model Organisms Center via the Cas9-targeted single guide RNA of 5′ ATGCCCGGAAGCCCAGCTGCTGG 3′. The generation protocol for Sema7a R145W mutant mice has been described previously [ 8 , 9 ]. Liver samples were collected from wild-type (n = 4) and Sema7a R145W homozygous mice (n = 5).…”

“…Accumulating evidence has shown that the SEMA7A R148W mutation ( Sema7a R145W in mice) is a gain-of-function mutation and a risk factor involved in progressive familial intrahepatic cholestasis (PFIC) and non-alcoholic fatty liver disease (NAFLD). Pan et al demonstrated that the SEMA7A R148W mutation could disturb bile acid transport by reducing bile salt export pump and multidrug resistance-associated protein-2 expression, resulting in PFIC development [ 8 ]. Zhao et al reported that the mutation could promote hepatocyte lipid accumulation via integrin β1 and aggravate NAFLD progression [ 9 ].…”

Guidelines for the Management of Cholestatic Liver Diseases (2021)

“…A recent study reported that a novel type of PFIC could be induced by a homozygous R148W mutation of the SEMA7A gene. 30 At present, there no curative drugs for FIC, but UDCA and bile acid blocking agents are generally recommended. A dietary supplement of medium-chain triglycerides and fat-soluble vitamins are also generally recommended.…”