A highly conserved enhancer in mammalian type X collagen genes drives high levels of tissue-specific expression in hypertrophic cartilage in vitro and in vivo

Gebhard, Sonja; Pöschl, Ernst; Riemer, Silvia; Bauer, Elisabeth; Hattori, Takako; Eberspaecher, Heidi; Zhang, Zhaoping; Lefebvre, Veronique H. L.; Crombrugghe, Benoít de; Mark, Klaus von der

doi:10.1016/j.matbio.2004.05.010

Cited by 38 publications

(77 citation statements)

References 67 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The Col10a1-Luc reporter, pGL4600Int, was a kind gift from Klaus von der Mark, Erlangen, Germany (34,40). A 2.3-kb fragment from pCol10a1-SAbetageobpA (33) was transferred into the pGL3 basic vector to generate pGL3-Col10a1-(Ϫ2128/ϩ201), which was used as template for PCR for deletion mutants employing a common reverse primer (GCCTCGAGGGCAGCTTTCCTGGCTTC-CTC) and the following forward primers: Col10a1-(Ϫ60/ϩ52), CGGAGCTCGGCTCAGGGGAACTTCATGC; Col10a1-(Ϫ34/ϩ52), CGGAGCTCGGAAGAAAACAGTATAAAA-TAC.…”

Section: Methodsmentioning

confidence: 99%

“…Promoters-To examine whether GADD45␤ could participate in transactivating the Col10a1 promoter, we used a Luc reporter construct driven by 4.6 kb of Col10a1 promoter sequence, which produces strong expression in hypertrophic chondrocytes (33,34,40,51,52), and another Luc reporter with 1.6 kb of the MMP13 promoter as a reference control (8). First, cotransfection of Fra2 and GADD45␤, alone or in combination, revealed little or no response of the Col10a1 promoter compared with the positive response of MMP13-Luc (Table 2, top).…”

Section: Gadd45␤ Promotes C/ebp Transactivation Of the Col10a1 And Mmp13mentioning

confidence: 99%

“…Col10a1 gene activation requires a Runx2 binding site located in its distal promoter (33,34), as well as a non-consensus Runx2 binding site located in the proximal promoter region (35). In addition, the Fra2 knock-out phenotype is characterized by impaired hypertrophic differentiation of chondrocytes in the embryonic growth plate, along with reduced Col10a1 mRNA expression levels (36).…”

mentioning

confidence: 99%

See 2 more Smart Citations

GADD45β Enhances Col10a1 Transcription via the MTK1/MKK3/6/p38 Axis and Activation of C/EBPβ-TAD4 in Terminally Differentiating Chondrocytes

Tsuchimochi

Otero

Dragomir

et al. 2010

Journal of Biological Chemistry

View full text Add to dashboard Cite

GADD45␤ (growth arrest-and DNA damage-inducible) interacts with upstream regulators of the JNK and p38 stress response kinases. Previously, we reported that the hypertrophic zone of the Gadd45␤ ؊/؊ mouse embryonic growth plate is compressed, and expression of type X collagen (Col10a1) and matrix metalloproteinase 13 (Mmp13) genes is decreased. Herein, we report that GADD45␤ enhances activity of the proximal Col10a1 promoter, which contains evolutionarily conserved AP-1, cAMP-response element, and C/EBP half-sites, in synergism with C/EBP family members, whereas the MMP13 promoter responds to GADD45␤ together with AP-1, ATF, or C/EBP family members. C/EBP␤ expression also predominantly co-localizes with GADD45␤ in the embryonic growth plate. Moreover, GADD45␤ enhances C/EBP␤ activation via MTK1, MKK3, and MKK6, and dominant-negative p38␣apf, but not JNKapf, disrupts the combined trans-activating effect of GADD45␤ and C/EBP␤ on the Col10a1 promoter. Importantly, GADD45␤ knockdown prevents p38 phosphorylation while decreasing Col10a1 mRNA levels but does not affect C/EBP␤ binding to the Col10a1 promoter in vivo, indicating that GADD45␤ influences the transactivation function of DNA-bound C/EBP␤. In support of this conclusion, we show that the evolutionarily conserved TAD4 domain of C/EBP␤ is the target of the GADD45␤-dependent signaling. Collectively, we have uncovered a novel molecular mechanism linking GADD45␤ via the MTK1/MKK3/6/p38 axis to C/EBP␤-TAD4 activation of Col10a1 transcription in terminally differentiating chondrocytes.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Gadd45␤ Promotes C/ebp Transactivation Of the Col10a1 And Mmp13mentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

GADD45β Enhances Col10a1 Transcription via the MTK1/MKK3/6/p38 Axis and Activation of C/EBPβ-TAD4 in Terminally Differentiating Chondrocytes

Tsuchimochi

Otero

Dragomir

et al. 2010

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Northern Hybridization-RNA isolated from bovine chondrocytes was separated by electrophoresis in agarose-formaldehyde gels and transferred to a nylon membrane by semidry blotting as described previously (46). For Northern hybridization the following [␣-…”

Section: Methodsmentioning

confidence: 99%

“…32 P]dCTP-labeled probes were used: ␣1(X) mRNA, a 2.2-kb insert form the human clone SX2200 (46); TSG mRNA, a 397-bp probe amplified from the coding region with the primer pair 5ЈbTSGcod (CTCTGGGATGAGTGCT-GTGA) and 3ЈbTSGcod (TGTGGAACCAGCGATACTTG).…”

Section: Methodsmentioning

confidence: 99%

Twisted Gastrulation Modulates Bone Morphogenetic Protein-induced Collagen II and X Expression in Chondrocytesin Vitroandin Vivo

et al. 2006

Self Cite

View full text Add to dashboard Cite

Twisted gastrulation (TSG) is an extracellular modulator of bone morphogenetic protein (BMP) activity and regulates dorsoventral axis formation in early Drosophila and Xenopus development. Studies on tsg-deficient mice also indicated a role of this protein in skeletal growth, but the mechanism of TSG activity in this process has not yet been investigated. Here we show for the first time by in situ hybridization and immunohistochemistry that TSG is strongly expressed in bovine and mouse growth plate cartilage as well as in fetal ribs, vertebral cartilage, and cartilage anlagen of the skull. Furthermore we provide evidence that TSG is directly involved in BMP-regulated chondrocyte differentiation and maturation. In vitro, TSG impaired the dose-dependent BMP-2 stimulation of collagen II and X expression in cultures of MC615 chondrocytes and primary mouse chondrocytes. In the presence of chordin, a BMP antagonist, the inhibitory effect of TSG was further enhanced. TSG also inhibited BMP-2-stimulated phosphorylation of Smad factors in chondrocytes, confirming the role of TSG as a modulator of BMP signaling. For analysis of TSG functions in cartilage development in vivo, the gene was overexpressed in transgenic mice under the control of the cartilage-specific Col2a1 promoter. As a result, Col10a1 expression was significantly reduced in the growth plates of transgenic embryos and newborns in comparison with wild type littermates as shown by in situ hybridization and by real time PCR analysis. The data suggest that TSG is an important modulator of BMP-regulated cartilage development and chondrocyte differentiation.Bone morphogenetic proteins (BMPs) 5 are key regulators in the formation of cartilage models of vertebrate long bones, vertebrae, and ribs and their transition to bone during endochondral ossification (for reviews, see Refs. 1-5). However, the role of BMP factors in cartilage development and chondrocyte differentiation is complex and differs with time and site of chondrogenic differentiation: BMPs control limb outgrowth by negatively modulating apical ectodermal ridge activity (6 -8), whereas BMPs are required for the formation of prechondrogenic mesenchyme and chondrocyte differentiation in the limb (9). The ability of BMP-2, BMP-4, and others to induce chondrogenic differentiation of undifferentiated stems cells in vivo and in vitro has been amply demonstrated (10 -12). In line with this observation is the finding that chondrogenesis in vivo is impaired by blocking BMP activities with noggin (13, 14) or deletion of the BMP receptor (BMPRIB) (15).The role of BMPs during chondrocyte maturation and hypertrophy is also complex and controversially discussed: several studies show that BMP factors such as BMP-6 and BMP-7 stimulate hypertrophic differentiation of chondrocytes and promote collagen X expression (16 -18), thus preparing growth plate cartilage for replacement by endochondral bone. On the other hand, it was reported that BMP-2 and BMP-4 overexpression in developing chick limbs caused delayed hypertroph...

show abstract

Identification of the core element responsive to runt‐related transcription factor 2 in the promoter of human type x collagen gene

Higashikawa¹,

Saito²,

Ikeda³

et al. 2008

Arthritis & Rheumatism

View full text Add to dashboard Cite

Objective. Type X collagen and runt-related transcription factor 2 (RUNX-2) are known to be important for chondrocyte hypertrophy during skeletal growth and repair and development of osteoarthritis (OA) in mice. Aiming at clinical application, this study was undertaken to investigate transcriptional regulation of human type X collagen by RUNX-2 in human cells.Methods. Localization of type X collagen and RUNX-2 was determined by immunohistochemistry, and their functional interaction was examined in cultured mouse chondrogenic ATDC-5 cells. Promoter activity of the human type X collagen gene (COL10A1) was examined in human HeLa, HuH7, and OUMS27 cells transfected with a luciferase gene containing a 4.5-kb promoter and fragments. Binding to RUNX-2 was examined by electrophoretic mobility shift assay and chromatin immunoprecipitation.Results. RUNX-2 and type X collagen were colocalized in mouse limb cartilage and bone fracture callus. Gain and loss of function of RUNX-2 revealed that RUNX-2 is essential for type X collagen expression and terminal differentiation of chondrocytes. Human COL10A1 promoter activity was enhanced by RUNX-2 alone and more potently by RUNX-2 in combination with the coactivator core-binding factor ␤ in all 3 human cell lines examined. Deletion, mutagenesis, and tandem repeat analyses identified the core responsive element as the region between ؊89 and ؊60 bp (termed the hypertrophy box [HY box]), which showed specific binding to RUNX-2. Other putative RUNX-2 binding motifs in the human COL10A1 promoter did not respond to RUNX-2 in human cells.Conclusion. Our findings indicate that the HY box is the core element responsive to RUNX-2 in human COL10A1 promoter. Studies on molecular networks related to RUNX-2 and the HY box will lead to treatments of skeletal growth retardation, bone fracture, and OA.Hypertrophic differentiation of chondrocytes during endochondral ossification is an essential step in skeletal growth and repair (1,2). We and others have reported that chondrocyte hypertrophy also contributes to cartilage degradation during the development of osteoarthritis (OA) (3-5). Type X collagen is a short, network-forming collagen specifically expressed by hypertrophic chondrocytes (6). The physiologic importance of type X collagen has been shown by the impairment of endochondral ossification and skeletal growth that results from loss of function of the type X collagen gene in mice (7-9). Similarly, mutations in the carboxyterminal domain of the human type X collagen gene (COL10A1) cause a severe skeletal disorder called Schmid-type metaphyseal chondrodysplasia, with growth retardation, waddling gait, and OA (10-12). Hence, elucidation of the mechanisms regulating the type X collagen gene will contribute to understanding the molecular backgrounds of skeletal growth and repair and OA not only in mice, but also in humans.

show abstract

A highly conserved enhancer in mammalian type X collagen genes drives high levels of tissue-specific expression in hypertrophic cartilage in vitro and in vivo

Cited by 38 publications

References 67 publications

GADD45β Enhances Col10a1 Transcription via the MTK1/MKK3/6/p38 Axis and Activation of C/EBPβ-TAD4 in Terminally Differentiating Chondrocytes

GADD45β Enhances Col10a1 Transcription via the MTK1/MKK3/6/p38 Axis and Activation of C/EBPβ-TAD4 in Terminally Differentiating Chondrocytes

Twisted Gastrulation Modulates Bone Morphogenetic Protein-induced Collagen II and X Expression in Chondrocytesin Vitroandin Vivo

Identification of the core element responsive to runt‐related transcription factor 2 in the promoter of human type x collagen gene

Contact Info

Product

Resources

About