A heterologous prime/boost immunisation strategy protects against virulent E. ruminantium Welgevonden needle challenge but not against tick challenge

Pretorius, Ashley; Kleef, Mirinda Van; Collins, Nicola E.; Tshikudo, N.; Louw, E.; Faber, Erika; Strijp, M.F. Van; Allsopp, B. A.

doi:10.1016/j.vaccine.2008.06.006

Cited by 35 publications

(32 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…One way to deal with this is to formulate customised vaccines incorporating the immunotypes from the target region, and this approach has shown some success in Burkina Faso (73). A technical problem afflicting all heartwater vaccine development is that a natural tick challenge is much more virulent than an experimental needle challenge (61,74). This problem requires that a method be developed for delivering quantified experimental challenges with infected ticks.…”

Section: Inactivated Vaccine Developmentmentioning

confidence: 99%

Heartwater – Ehrlichia ruminantium infection

Allsopp¹

2015

Rev. Sci. Tech. OIE

Self Cite

View full text Add to dashboard Cite

SummaryHeartwater is a notifiable disease that is listed by the World Organisation for Animal Health. It is caused by Ehrlichia ruminantium, an obligately intracellular Gramnegative bacterium in the order Rickettsiales and the family Anaplasmataceae. The disease is borne by ticks in the genus Amblyomma and causes heartwater, or cowdriosis, in wild and domestic ruminants, primarily in Africa, but also in parts of the Caribbean. The disease was recognised in South Africa in the 19th Century and determined to be tick borne in 1900, while the organism was identified in 1925 and first cultured in vitro in 1985. This latter achievement boosted research into the disease at a time when biology was moving into the molecular genetic age. Over the last 20 years, there have been significant improvements in our understanding of E. ruminantium, yielding major advances in diagnosis, epidemiology, genetic characterisation, phylogeny, immunology, and vaccine development. The organism is genetically highly variable; this has important implications for future control measures, and is making it difficult to develop an effective vaccine for protection against tick challenge. Research is continuing into three different types of vaccine, inactivated, attenuated, and recombinant, and the current state of development of each is discussed. KeywordsAmblyomma hebraeum -Amblyomma variegatum -Attenuated vaccine -ControlCowdriosis -Diagnosis -Economic importance -Ehrlichia ruminantium -Heartwater -Inactivated vaccine -Occurrence -Recombinant vaccine -Tick-borne disease.Rev. Sci. Tech. Off. Int. Epiz., 2015, 34 (2), 557-568 AetiologyHeartwater is listed by the World Organisation of Animal Health as a notifiable disease (1). It was known in South Africa for nearly 90 years before the causative organism was identified in 1925 as a rickettsia, originally named Rickettsia ruminantium (2, 3). The name was later changed to Cowdria ruminantium (4), from which arose the term 'cowdriosis'. Molecular phylogenetic studies of the Rickettsiales in the 1990s uncovered the real evolutionary relationships within the order and the organism was reclassified as Ehrlichia ruminantium in the family Anaplasmataceae (5). Ehrlichia ruminantium, which is transmitted by Amblyomma ticks, is obligately intracellular, infects cattle, sheep, goats and some wild ruminants, and is frequently fatal. A comprehensive account of the history and biology of E. ruminantium can be found elsewhere (6). Economic and social importanceHeartwater is a serious economic problem wherever it occurs, in an enormous area covering most of sub-Saharan Africa, its offshore islands, and several islands in the Caribbean. The disease generally prevents livestock farmers from upgrading their herds to modern high-yielding breeds, as these are more susceptible to infection than traditional stock breeds, which often have a measure of resistance (7). Since heartwater is so common in the endemic areas of Africa, farmers are usually unwilling or unable to pay for definitive diagnoses, so it is difficul...

show abstract

Section: Inactivated Vaccine Developmentmentioning

confidence: 99%

Heartwater – Ehrlichia ruminantium infection

Allsopp¹

2015

Rev. Sci. Tech. OIE

Self Cite

View full text Add to dashboard Cite

show abstract

“…These ORFs are known to provide protective immunity against a heartwater needle challenge in sheep (Pretorius et al, 2007(Pretorius et al, , 2008. To achieve this, we developed a microencapsulation method that is capable of fast initial release of pDNA followed by a Fig.…”

Section: Discussionmentioning

confidence: 99%

“…The 4 E. ruminantium 1H12 ORFs were previously cloned and expressed using the Invitrogen Champion TM pET Directional TOPO ® Expression kit, according to the manufacturer's instructions (Pretorius et al, 2008). To improve levels of protein expression of rErum2540, the signal peptide sequence was removed.…”

Section: Protein Expressionmentioning

confidence: 99%

“…The forward primer specific for the rErum2540 ORF was redesigned downstream of the signal peptide (CACCACATACCAGAATGGGTATTCTG) and used with the previously designed reverse primer in a PCR catalysed by a proof reading polymerase (Pfu, Promega) that produces blunt-ended products. The PCR product was subcloned into the pET vector as described previously (Pretorius et al, 2008). Large-scale production of rproteins of all Erums were obtained by autoinduction of BL21 Star TM (DE3) bacterial cells in 1 l of Overnight Express TM Instant TB Medium containing ampicillin (50 g/ml) following electroporation in the BIORAD gene Pulser ® II at 1.4 kV.…”

Section: Protein Expressionmentioning

confidence: 99%

“…This underlines the need for an improved vaccine, preferably one which does not require cold storage as with the blood vaccine used in the infection and treatment method. A DNA vaccine consisting of a cocktail of 4 1H12 open reading frames (ORFs) has been found to protect sheep against a homologous needle challenge using either 3 DNA inoculations (Pretorius et al, 2007) or alternatively, a DNA prime-recombinant (r)1H12 protein boost vaccination strat-egy (Pretorius et al, 2008). This approach was, however, not fully successful in the field.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations