A facile <scp>PCR</scp>‐<scp>RFLP</scp> method for genotyping of <i><scp>ITPA</scp></i> rs1127354 and rs7270101 polymorphisms

Alavian, Seyed Ehsan; Sharafi, Heidar; Shirmast, Paniz; Alavian, Seyed Moayed; Behnava, Bita; Pouryasin, Mohammad; Keshvari, Maryam; Pouryasin, Ali

doi:10.1002/jcla.22440

Cited by 3 publications

(6 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The results showed that all of the 100 samples tested with PCR-RFLP and sequencing had exactly the same results, with 100% concordance. This demonstrates the utility of RFLP-PCR in studying SNPs with as high efficiency and reliability as Sanger sequencing, but at a reduced cost (Alavian et al 2018).…”

Section: Description Of the Polymerase Chain Reaction-restriction Fragment Length Polymorphism Technique And Exemplary Applicationsmentioning

confidence: 83%

“…One of the many practical examples of the application of RFLP-PCR in SNP genotyping is that performed by Alavian et al (2018) for the detection of the rs1127354 and rs7270101 polymorphisms associated with the inosine triphosphate pyrophosphatase (ITPA) gene. rs1127354 and rs7270101 SNPs are associated with a functional impairment in ITPase, resulting in anaemia protection in patients with chronic hepatitis C virus (HCV) infection undergoing ribavirin (RBV)-dependent regimens.…”

Section: Description Of the Polymerase Chain Reaction-restriction Fragment Length Polymorphism Technique And Exemplary Applicationsmentioning

confidence: 99%

See 1 more Smart Citation

Application of polymerase chain reaction-restriction fragment length polymorphism (RFLP-PCR) in the analysis of single nucleotide polymorphisms (SNPs)

Tarach

2021

FBOe

View full text Add to dashboard Cite

Polymerase chain reaction-restriction fragment length polymorphism (RFLP-PCR) is a technique used to identify single nucleotide polymorphisms (SNPs) based on the recognition of restriction sites by restriction enzymes. RFLP-PCR is an easy-to-perform and inexpensive tool for initial analysis of SNPs potentially associated with some monogenic diseases, as well as in genotyping, genetic mapping, lineage screening, forensics and ancient DNA analysis. The RFLP-PCR method employs four steps: (1) isolation of genetic material and PCR; (2) restriction digestion of amplicons; (3) electrophoresis of digested fragments; and (4) visualisation. Despite its obsolescence and the presence of high-throughput DNA analysis techniques, it is still applied in the analysis of SNPs associated with disease entities and in the analysis of genetic variation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). RFLP-PCR is a low-cost and low-throughput research method allowing for the analysis of SNPs in the absence of specialised equipment, and it is useful when there is a limited budget.

show abstract

Section: Description Of the Polymerase Chain Reaction-restriction Fragment Length Polymorphism Technique And Exemplary Applicationsmentioning

confidence: 83%

Section: Description Of the Polymerase Chain Reaction-restriction Fragment Length Polymorphism Technique And Exemplary Applicationsmentioning

confidence: 99%

Application of polymerase chain reaction-restriction fragment length polymorphism (RFLP-PCR) in the analysis of single nucleotide polymorphisms (SNPs)

Tarach

2021

FBOe

View full text Add to dashboard Cite

show abstract

“…Only patients with the undetectable viral RNA at CVR and at follow-up 24 weeks after completion of treatment were considered to have achieved SVR (Sustained viral response). The rate of SVR achievement was recorded as Per protocol analysis (PPA) means those patients were included in the study who adhered to anti-viral therapy till the finishing point and their post-treatment SVR status was assessed [ 21 ]. A decline in hemoglobin levels in HCV patients after using DAA (sofosbuvir ribavirin) treatment was also noted [ 5 ].…”

Section: Methodsmentioning

confidence: 99%

“…ITPA gene amplification was performed with conventional PCR using (Thermo Scientific by Thermo Fisher) PCR master with 5–10 ng/µl DNA. Forward primer F-5′‐AGATGGGCAGCAGAGTTATCG‐3′ and the reverse primer was R‐5′‐AGACAGAGAAATCCAACCATCTTTTAAGAA 3′ [ 21 ]. The thermal cycle conditions were as described in our previous study [ 23 ].…”

Section: Methodsmentioning

confidence: 99%

“…Following PCR, the ITPA genotypes were initially analyzed using RFLP (Restriction fragment length polymorphism). For RFLP, PCR products 213 bp were treated overnight with restriction enzymes Xcel and Mboll to investigate rs1127354 and rs7270101 variants polymorphisms respectively [ 21 ]. The ITPA genotype results were confirmed through Sanger sequencing and results were analyzed by Chromas version 2.5.0.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Impact of ITPA gene polymorphism for predicting anemia and treatment outcome in HCV infected patients taking Sofosbuvir Ribavirin therapy

Amjed,

Saleem,

Ullah

et al. 2024

BMC Infect Dis

View full text Add to dashboard Cite

Background Globally, 80 million people are suffering from chronic Hepatitis C virus (HCV) infection. Sofosbuvir ribavirin-based anti-HCV therapy is associated with anemia and other adverse effects. Polymorphisms of Inosine triphosphatase (ITPA) gene may cause functional impairment in the Inosine triphosphate pyrophosphatase enzyme, resulting in enhanced sustained viral response (SVR) and protection from ribavirin-associated anemia in patients on therapy. The study objective was to investigate the effect of Inosine triphosphatase gene polymorphism on SVR achievement, hemoglobin decline and ribavirin dose reduction in patients on therapy. Methods This prospective cohort study was of 170 hepatitis C infected patients received 6-month sofosbuvir ribavirin therapy. Patient viral load, reduction in ribavirin amount, liver function test, and complete blood count were noted monthly. Inosine triphosphatase variants rs1127354 and rs7270101 were assessed through the restriction fragment length polymorphism and confirmed using Sanger sequencing. The impact of polymorphism on cumulative reduction of ribavirin, and anti-HCV therapy outcome were studied. Results A total of 74.3% of patients had ITPA rs1127354 CC genotype, 25.7% were CA and AA 0%. The frequency of ITPA genotype rs7270101-AA was 95%, AC 5%, and CC was 0%. ITPA rs1127354-CA had a notably positive impact on SVR achievement with a zero-relapse rate. ITPA rs1127354-CA genotype was significantly (P ˂0.05) protective against ≥ 2 g/dl Hb reduction from baseline to 1st, 2nd and 6th months of therapy. During treatment, Hb reduction ≥ 10 g/dl was frequently observed in rs1127354-CC genotype and rs7270101-AA genotype patients. Ribavirin dose reduction was significantly (P ˂0.05) high in rs1127354-CC genotype as compared to genotype CA whereas no significant difference was observed in ribavirin dose reduction in rs7270101 AA and non-AA genotype. Patient baseline characteristics such as age, body mass index, rs1127354-CC genotype, and baseline Hb were significantly associated with significant Hb reduction. Conclusion Pretreatment evaluation of ITPA polymorphism can be a diagnostic tool to find out patients at risk of anemia and improve treatment adherence. ITPA genotype rs1127354-CA contributes to improved compliance with ribavirin dose and protects against hemoglobin decline in HCV patients while taking ribavirin-based therapy. However, ITPA rs1127354, rs7270101 polymorphism have no significant impact on SVR achievement.

show abstract

Genotyping of rs1127354 and rs7270101 SNPs in Multiple Sclerosis Patients: Correlation with ITPA Gene Expression

Shirvani-Farsani,

Fardi,

Sahraian

et al. 2024

Jentashapir J Cell Mol Biol

View full text Add to dashboard Cite

Background: The ITPA gene plays a vital role in maintaining cellular homeostasis by regulating the levels of inosine triphosphate (ITP) and diphosphate (IDP) within cells. Dysregulation of ITPA can lead to an accumulation of ITP and IDP, which disrupts immune cell functions. Objective: This study aims to investigate, for the first time, the relationship between two specific genetic variations (94C- > A (rs1127354) and IVS2+21A → C (rs7270101) SNPs) and the expression of the ITPA gene in multiple sclerosis (MS) patients. Methods: The study included 112 MS patients and 109 healthy controls, with 32 patients and 30 controls randomly selected for genotyping. The expression of two ITPA transcripts in the peripheral blood mononuclear cells of all participants was measured using real-time PCR. Results: The study found no significant differences in the expression levels of transcript 1 and transcript 2 between MS patients and controls. Additionally, there were no significant differences in the genotypic and allele frequencies of the ITPA rs1127354 and rs7270101 SNPs in MS patients. Conclusions: These findings may contribute to the development of targeted therapies and personalized treatments for individuals with MS. Understanding the pathogenic potential and frequency distribution of these variants across diverse populations is crucial for elucidating their role in disease susceptibility and advancing personalized medicine approaches for multiple sclerosis and other autoimmune disorders.

show abstract

A facile PCR‐RFLP method for genotyping of ITPA rs1127354 and rs7270101 polymorphisms

Abstract: We developed and validated a rapid and inexpensive PCR-RFLP technique for the detection of ITPA rs1127354 and rs7270101 gene polymorphisms.

Cited by 3 publications

References 28 publications

Application of polymerase chain reaction-restriction fragment length polymorphism (RFLP-PCR) in the analysis of single nucleotide polymorphisms (SNPs)

Application of polymerase chain reaction-restriction fragment length polymorphism (RFLP-PCR) in the analysis of single nucleotide polymorphisms (SNPs)

Impact of ITPA gene polymorphism for predicting anemia and treatment outcome in HCV infected patients taking Sofosbuvir Ribavirin therapy

Genotyping of rs1127354 and rs7270101 SNPs in Multiple Sclerosis Patients: Correlation with ITPA Gene Expression

Contact Info

Product

Resources

About