A European epidemiological survey of Vibrio splendidus clade shows unexplored diversity and massive exchange of virulence factors

Abstract

The Vibrio splendidus clade has previously been associated with epidemic outbreaks of various aquatic animals, as in the case of the cupped oyster, Crassostrea gigas. To investigate whether involved strains could present a clonal origin and to identify possible alternative background carriage animals or zooplankton, a large epidemiological survey was conducted on isolates of the splendidus clade. For this purpose, Vibrio strains were isolated from various samples including oysters, mussels, sediments, zooplankton, and sea water on the basis of a North/South gradient of the European sea water zone (Ireland, The Netherlands, France, Italy, and Spain). A total of 435 isolates were successfully associated to the V. splendidus clade using real time polymerase chain reaction with 16S specific primers and probes. A multiple-locus variable-number tandem-repeat analysis (VNTR) was conducted on all isolates based on a multiplex PCR-VNTR with a set of primer pairs designed from the V. tasmaniensis LGP32 genome. Preliminary validation of the primers on a set of collection strains from the V. splendidus clade confirmed that the former V. splendidus-related LGP32 and relative strains were related to V. tasmaniensis rather than to the type strain V. splendidus LMG 4042. The VNTR analysis was then successfully conducted on 335 isolates which led to the characterization of 87 different profiles. Our results showed that (1) the high diversity of VNTR did not enlighten significant correlation between a specific pattern and the origin of collected samples. However, populations isolated from animal samples tend to differ from those of the background environment; (2) oyster mortality events could not be linked to the clonal proliferation of a particular VNTR type. However, few different patterns seemed successively associated with samples collected during peaks of oyster's mortality. (3) Finally, no correlation could be seen between specific VNTR patterns and sequence phylogeny of the virulence factors vsm and ompU that were detected among strains isolated during as well as outside mortality events. These results, combined with incongruence observed between the ompU and vsm phylogenetic trees, suggested both large diffusion of strains and massive lateral gene transfer within the V. splendidus clade.

High mortality of mussels in northern Brittany – Evaluation of the involvement of pathogens, pathological conditions and pollutants

“…The first step to determine the bacterial profile of the mussel batches consisted in discriminating between strains related to the V. splendidus clade (V. splendidus-related species) and other marine bacteria, as some vibrio strains belonging to this Splendidus clade are known to be pathogenic for molluscs. One TaqMan ® real-time PCR, targeting the 16S rRNA gene of V. splendidus-related strains (PCR1) (Oden et al, 2016), was carried out on a Smart Cycler ® (Cepheid, USA); the primers used for PCR1 were SpF1 5'ATCATGGCTCAGATTGAACG3' and SpR1 5'CAATGGTTATCCCCCACATC3' (Nasfi et al, 2015)…”

Experimental infection of Mytilus edulis by two Vibrio splendidus‐related strains: Determination of pathogenicity level of strains and influence of the origin and annual cycle of mussels on their sensitivity

“…The successful extraction was confirmed by DNA quantification with NanoDrop TM 2000c spectrophotometer (Thermo Fisher Scientific ™ ), and strains were then characterized by molecular analysis. One TaqMan ® real‐time PCR targeting the 16S rRNA gene of V. splendidus ‐related strains (PCR1) (Oden, Burioli, Trancart, Pitel, & Houssin, ) was carried out on a Smart Cycler ® (Cepheid); the primers used for PCR1 were SpF1 5′ATCATGGCTCAGATTGAACG3′ and SpR1 5′CAATGGTTATCCCCCACATC3′ (Nasfi et al, ) and the probe SpProbe (5′‐3′) FAM‐CCCATTAACGCACCCGAAGGATTG‐BHQ1. The reaction volume of 25 µl contained 12.5 µl of Premix Ex Taq ® 2× Takara ® (Lonza), 0.5 µl of each primer (20 µM), 0.5 µl of probe (10 µM), 9 µl of purified water and 2 µl of extracted DNA (replaced with 2 µl of purified water in the negative control).…”

“…The successful extraction was confirmed by DNA quantification with NanoDrop TM 2000c spectrophotometer (Thermo Fisher Scientific ™ ), and strains were then characterized by molecular analysis. One TaqMan ® real-time PCR targeting the 16S rRNA gene of V. splendidus-related strains (PCR1) (Oden, Burioli, Trancart, Pitel, & Houssin, 2016) was carried out on a Smart Cycler ® (Cepheid); the primers used for PCR1 were SpF1 5′ATCATGGCTCAGATTGAACG3′ and SpR1 5′CAATGGTTATCCCCCACATC3′ (Nasfi et al, 2015) and the probe…”

First evidence of viral and bacterial oyster pathogens in the Brazilian coast

“…It is important to note, however, that we cannot infer which species of bacteria of the Splendidus clade is present within all other (non‐sequenced) positive samples, as the primer pair used seems to be able to amplify sequences not only from V. splendidus , but also from V. tasmaniensis (positive control). As both virulent and avirulent bacterial isolates belonging to the Splendidus clade are reported in the literature (Nasfi et al., ), further studies are necessary to better identify the potential threat to oysters from the coast of Santa Catarina caused by pathogenic Vibrio .…”

“…Splendidus clade is present within all other (non-sequenced) positive samples, as the primer pair used seems to be able to amplify sequences not only from V. splendidus, but also from V. tasmaniensis (positive control). As both virulent and avirulent bacterial isolates belonging to the Splendidus clade are reported in the literature(Nasfi et al, 2015), further studies are necessary to better identify the potential threat to oysters from the coast of Santa Catarina caused by pathogenic Vibrio.In this study, DNA sequences showing high similarity to sequences belonging to OsHV-1 and a V. splendidus-related bacteria were detected among DNA extracted from tissues of Pacific and native oysters reared in the southern Brazilian coast. Although further confirmation using different techniques (e.g., in situ hybridization and bacterial isolation) is highly encouraged, this study provided a first warning of the potential presence of these oyster pathogens and encourage actions that may minimize the risk of oyster mortality outbreaks.…”