A directional recombination cloning system for restriction- and ligation-free construction of GFP, DsRed, and lacZ transgenic Drosophila reporters

Swanson, Christina I.; Hinrichs, Trish; Johnson, Lisa A.; Zhao, Ying; Barolo, Scott

doi:10.1016/j.gene.2007.11.003

Cited by 11 publications

(11 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For our in vivo analysis of the spa enhancer, we used a specially built Gateway reporter transgene vector, Ganesh-G1, in which enhancers are placed upstream of a minimal, TATA-containing promoter taken from the Drosophila Hsp70 gene, driving an EGFP-NLS reporter (Swanson et al, 2008). An important feature of this vector is that the enhancer is placed 846 bp upstream from the transcription start site (Figure 1A), so that in all experiments presented here (except those in Figure 4), the enhancer is forced to act at a moderate distance from the promoter.…”

Section: Resultsmentioning

confidence: 99%

“…When targeting mutations in the interior of spa , such as in constructs m4A, m4-rs, etc., we separately amplified 5′ and 3′ fragments, using overlapping tagged primers to integrate mutated sequence, and then joined the fragments using overlap extension (Swanson et al, 2008 and references therein). In our sewing PCR protocol, the 5′ and 3′ fragments (which overlap by 20 bp) were separately PCR amplified and gel purified.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Structural Rules and Complex Regulatory Circuitry Constrain Expression of a Notch- and EGFR-Regulated Eye Enhancer

2010

Self Cite

View full text Add to dashboard Cite

SUMMARY Enhancers integrate spatiotemporal information to generate precise patterns of gene expression. How complex is the regulatory logic of a typical developmental enhancer, and how important is its internal organization? Here, we examine in detail the structure and function of sparkling, a Notch- and EGFR/MAPK-regulated, cone cell-specific enhancer of the Drosophila Pax2 gene, in vivo. In addition to twelve previously identified protein binding sites, sparkling is densely populated with previously unmapped regulatory sequences, which interact in complex ways to control gene expression. One segment is essential for activation at a distance, yet dispensable for other activation functions and for cell-type patterning. Unexpectedly, rearranging sparkling’s regulatory sites converts it into a robust photoreceptor-specific enhancer. Our results show that a single combination of regulatory inputs can encode multiple outputs, and suggest that the enhancer’s organization determines the correct expression pattern by facilitating certain short-range regulatory interactions at the expense of others.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Structural Rules and Complex Regulatory Circuitry Constrain Expression of a Notch- and EGFR-Regulated Eye Enhancer

2010

Self Cite

View full text Add to dashboard Cite

show abstract

“…For overexpression studies, both open reading frames of the sesB gene (sesB-1 and sesB-2) were cloned using the Gateway system. The entry and destination vectors used were obtained from the Drosophila Gateway Vector collection (46). The primers listed were used in PCR for each of the sesB isoforms: 5=CACCATGGGCAAGGATTTCGAT-GCTGTT3=, 5=CAAGACCTTCTTGATCTCATCGTACAA3= for sesB-1, and 5=CACCATGGGGAATATATCAGCATCCATA3=, 5=CAAGACCTTCTTGATCTCATCGTACAA3= for sesB-2.…”

Section: Methodsmentioning

confidence: 99%

Mislocalization of mitochondria and compromised renal function and oxidative stress resistance inDrosophila SesBmutants

Terhzaz

Cabrero

Chintapalli

et al. 2010

Physiological Genomics

View full text Add to dashboard Cite

Terhzaz S, Cabrero P, Chintapalli VR, Davies S, Dow JAT. Mislocalization of mitochondria and compromised renal function and oxidative stress resistance in Drosophila SesB mutants. Physiol Genomics 41: 33-41, 2010. First published December 15, 2009 doi:10.1152/physiolgenomics.00147.2009.-Mitochondria accumulate at sites of intense metabolic activity within cells, but the adaptive value of this placement is not clear. In Drosophila, sesB encodes the ubiquitous isoform of adenine nucleotide translocase (ANT, the mitochondrial inner membrane ATP/ADP exchanger); null alleles are lethal, whereas hypomorphic alleles display sensitivity to a range of stressors. In the adult renal tubule, which is densely packed with mitochondria and hence enriched for sesB, both hypomorphic alleles and RNA interference knockdowns cause the mitochondria to lose their highly polarized distribution in the tissue and to become rounded. Basal cytoplasmic and mitochondrial calcium levels are both increased, and neuropeptide calcium response compromised, with concomitant defects in fluid secretion. The remaining mitochondria in sesB mutants are overactive and maintain depleted cellular ATP levels while generating higher levels of hydrogen peroxide than normal. When sesB expression is knocked down in just tubule principal cells, the survival of the whole organism upon oxidative stress is reduced, implying a limiting role for the tubule in homeostatic response to stressors. The physiological impacts of defective ANT expression are thus widespread and diverse. Drosophila melanogaster; Malpighian tubule; adenine nucleotide translocase; mitochondria MITOCHONDRIA ARE ESSENTIAL organelles for the function of all aerobic cells, as they produce ATP, buffer cytosolic calcium, and sequester apoptotic factors. Impairment of mitochondrial function, resulting in excitotoxic metabolic insufficiency, cell death, and oxidative damage, can contribute to severe tissue pathologies and diseases (36,44). Mitochondria are also highly dynamic, and accumulate at sites with particularly high ATP consumption (3,13,17,31,37).The mitochondrial adenine nucleotide translocase (ANT) is the most abundant protein of the inner mitochondrial membrane and a crucial component in the maintenance of cellular energy homeostasis, as well as in the formation of the mitochondrial permeability transition pore (2, 15). It catalyzes ADP/ATP exchange across the mitochondrial inner membrane (24) and thus has the potential to allow mitochondrial sensing of subcellular ATP:ADP poise. ANT is a target of oxidative damage, and functional inactivation has been associated with chronological age as well as physiological age (51). In mammals, the majority of species, including humans, possess three distinct genes for ANT (9,25,26,28). Drosophila harbors two overlapping ANT genes, ANT1 (sesB), and ANT2, with 72% nucleotide identity with 78% amino acid sequence identity (52). Mutations affecting ANT1 in Drosophila were originally identified as a stress-sensitive strain of animals (sesB) that are condi...

show abstract

“…Flies overexpressing a construct of the CG2196 gene tagged with enhanced yellow fluorescent protein (eYFP) were generated using the Gateway system. The entry and destination vectors used were obtained from the Drosophila Gateway Vector collection (37). The open reading frame of the gene was obtained from an EST clone and inserted in-frame into the Gateway destination vector pTWV, so encoding fluorescently COOH-terminal tagged CG2196, and flies germ-line transformed as described previously.…”

Section: Methodsmentioning

confidence: 99%

Salty dog, an SLC5 symporter, modulatesDrosophilaresponse to salt stress

Stergiopoulos

Cabrero

Davies

et al. 2009

Physiological Genomics

View full text Add to dashboard Cite

To regulate their internal environments, organisms must adapt to varying ion levels in their diet. Adult Drosophila were exposed to dietary salt stress, and their physiological, survival, and gene expression responses monitored. Insects continued to feed on NaCl-elevated diet, although levels >4% wt/vol ultimately proved fatal. Affymetrix microarray analysis of flies fed on diet containing elevated NaCl showed a phased response: the earliest response was widespread upregulation of immune genes, followed by upregulation of carbohydrate metabolism as the immune response was downregulated, then finally a switch to amino acid catabolism and inhibition of genes associated with the reproductive axis. Significantly, the online transcriptomic resource FlyAtlas reports that most of the modulated genes are predominantly expressed in hindgut or Malpighian (renal) tubule, implicating these excretory tissues as the major responders to salt stress. Three genes were selected for further study: the SLC5 symporter CG2196, the GLUT transporter CG6484, and the transcription factor sugarbabe (previously implicated in starvation and stress responses). Expression profiles predicted by microarray were validated by quantitative PCR (qPCR); expression was mapped to the alimentary canal by in situ hybridization. CG2196::eYFP overexpression constructs were localized to the basolateral membrane of the Malpighian (renal) tubules, and RNAi against CG2196 improved survival on high-salt diet, even when driven specifically to just principal cells of the Malpighian tubule, confirming both this tissue and this transporter as major determinants of survival upon salt stress. Accordingly, CG2196 was renamed salty dog (salt).

show abstract

A directional recombination cloning system for restriction- and ligation-free construction of GFP, DsRed, and lacZ transgenic Drosophila reporters

Cited by 11 publications

References 28 publications

Structural Rules and Complex Regulatory Circuitry Constrain Expression of a Notch- and EGFR-Regulated Eye Enhancer

Structural Rules and Complex Regulatory Circuitry Constrain Expression of a Notch- and EGFR-Regulated Eye Enhancer

Mislocalization of mitochondria and compromised renal function and oxidative stress resistance inDrosophila SesBmutants

Salty dog, an SLC5 symporter, modulatesDrosophilaresponse to salt stress

Contact Info

Product

Resources

About