A deletion/inversion rearrangement of the beta-globin gene cluster in a Turkish family with delta beta zero-thalassemia intermedia

Abstract

The most common forms of hereditary persistence of fetal hemoglobin synthesis (HPFH) and delta beta zero-thalassemia result from simple deletions of the beta-globin gene cluster or from point mutations in the gamma-globin gene promoters. These naturally occurring mutants extend our understanding of globin gene regulation and hemoglobin switching. Furthermore, they provide the opportunity to test in vivo hypothetical switching models that are based on the experimental approach. We report here a family with delta beta zero-thalassemia from Turkey with a complex rearrangement of the beta-globin gene cluster that involves two deletions of 11.5 kb and 1.6 kb, and an inversion of 7.6 kb. The larger deletion removes both the delta-and the beta-globin genes with 3′ flanking sequences, whereas the smaller deletion affects DNA of unknown function. The inversion contains the entire L1 repeat 3′ of the beta-globin gene. There are structural motifs near the breakpoints (introduction of an “orphan” nucleotide, multiple direct and inverted repeats) suggesting a nonhomologous type of recombination event. The hematologic phenotype and the molecular structure of the rearranged beta-globin gene cluster are consistent with a competitive relationship between the fetal and the adult globin genes and/or with the translocation of enhancer sequences into the gamma-globin gene region.

Beta‐thalassaemia in the immigrant and non‐immigrant German populations

“…The identification strategy in these Germans selected for Kulozik et al (1991) for details; 3 see Kulozik et al (1993) for details; 4 see Kulozik et al (1992) for details. (Table IV).…”

Molecular analysis of the Turkish form of deletion‐inversion (δβ)° thalassaemia

“…Various restriction enzyme digested fragments were hybridized with 5Ј d probe; however, the abnormal band sizes obtained were not consistent with a deletion between the d gene and the pRK 28 region, as different Eco RI, Bam HI and Hind III fragments were detected with two probes (data not shown). Combining all the gene mapping data, it was concluded that this complex arrangement is the basis for the Turkish form of deletion-inversion (db)Њ-thalassaemia which was recently described by Kulozik et al (1992). A comparison indicated that the sequence motif of the deletion breakpoint was identical to that initially described by Kulozik et al (1992), including the presence of a single orphan nucleotide (þC) at the conjunction site of the 11 .…”

“…Combining all the gene mapping data, it was concluded that this complex arrangement is the basis for the Turkish form of deletion-inversion (db)Њ-thalassaemia which was recently described by Kulozik et al (1992). A comparison indicated that the sequence motif of the deletion breakpoint was identical to that initially described by Kulozik et al (1992), including the presence of a single orphan nucleotide (þC) at the conjunction site of the 11 . 5 kb deletion and 7 .…”

“…light after ethidium bromide staining. The 782 bp PCR product was then eluted from agorose gel (Fig 2) and the asymmetrically amplified fragment was directly sequenced using an internal primer (5Ј AATCTCAGGGCAAGTTAAGG 3Ј at position ¹140 5Ј to the d gene), and compared with the sequence published by Kulozik et al (1992).…”

“…The functional analysis of these developmental mutants has produced important insights into the delineation of the cis-acting regulatory elements of the b-globin locus (Palena et al, 1994). Kulozik et al (1992) have described a complex rearrangement of deletion-inversion type of (db)Њ-thalassaemia in a family originating from the Antalya region of Turkey. In this study a similar mutation is presented in two unrelated families who are from the same city where the above-mentioned subject originated.…”