A culture platform to study quiescent hematopoietic stem cells following genome editing

Shiroshita, Kohei; Kobayashi, Hiroshi; Watanuki, S.; Karigane, Daiki; Sorimachi, Yuriko; Fujita, Shin; Tamaki, Shinpei; Haraguchi, Miho; Itokawa, Naoki; Aoyoama, Kazumasa; Koide, Shuhei; Masamoto, Yosuke; Kobayashi, Kazuo; Nakamura‐Ishizu, Ayako; Kurokawa, Mineo; Iwama, Atsushi; Okamoto, Shinichiro; Kataoka, Keisuke; Takubo, Keiyo

doi:10.1016/j.crmeth.2022.100354

Cited by 6 publications

(13 citation statements)

References 95 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Cell count in HSC-derived colonies decreased following treatment with a PFKFB3 inhibitor under proliferative, but not quiescence-maintaining, conditions (Supplementary Figure 10B). We also knocked out Pfkfb3 in HSCs using the less toxic, vector-free CRISPR-Cas9 system and cultured the cells under quiescence-maintaining or proliferative conditions (Supplementary Figure 10A) based on recent reports by Shiroshita et al 66 . Again, cell numbers in Pfkfb3 -knockout (KO) HSC–derived colonies decreased only in proliferative cultures when compared to control cultures ( Rosa26 -KO HSCs) (Supplementary Figure 10C, E, F).…”

Section: Resultsmentioning

confidence: 99%

Context-Dependent Modification of PFKFB3 in Hematopoietic Stem Cells Promotes Anaerobic Glycolysis and Ensures Stress Hematopoiesis

Watanuki

Kobayashi

Yamamoto

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

Metabolic pathways are plastic and rapidly change in response to stress or perturbation. Current metabolic profiling techniques require lysis of many cells, complicating the tracking of metabolic changes over time after stress in rare cells such as hematopoietic stem cells (HSCs). Here, we aimed to identify the key metabolic enzymes that define metabolic differences between steady-state and stress conditions in HSCs and elucidate their regulatory mechanisms. Through quantitative13C metabolic flux analysis of glucose metabolism using high-sensitivity glucose tracing and mathematical modeling, we found that HSCs activate the glycolytic rate-limiting enzyme phosphofructokinase (PFK) during proliferation and oxidative phosphorylation (OXPHOS) inhibition. Real-time measurement of adenosine triphosphate (ATP) levels in single HSCs demonstrated that proliferative stress or OXPHOS inhibition led to accelerated glycolysis via increased activity of PFKFB3, the enzyme regulating an allosteric PFK activator, within seconds to meet ATP requirements. Furthermore, varying stresses differentially activated PFKFB3 via PRMT1-dependent methylation during proliferative stress and via AMPK-dependent phosphorylation during OXPHOS inhibition. Overexpression ofPfkfb3induced HSC proliferation and promoted differentiated cell production, whereas inhibition or loss ofPfkfb3suppressed them. This study reveals the flexible and multilayered regulation of HSC metabolism to sustain hematopoiesis under stress and provides techniques to better understand the physiological metabolism of rare hematopoietic cells.

show abstract

Section: Resultsmentioning

confidence: 99%

Context-Dependent Modification of PFKFB3 in Hematopoietic Stem Cells Promotes Anaerobic Glycolysis and Ensures Stress Hematopoiesis

Watanuki

Kobayashi

Yamamoto

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…The genome-edited HSCs in quiescence-maintaining culture maintained the original surface markers (CD150 + CD48 - Lin - Sca-1 + c-Kit + : SLAM-LSK), fresh HSC-like transcriptional profile, and high engraftment capacity compared to genome-edited HSCs in conventional proliferative culture. 1 …”

Section: Before You Beginmentioning

confidence: 99%

“… 1 N/A sgRNA Reversed primer: AAAAGCACCGACTCGGTGCCA CTTTTTCAAGTTGATAACGGACT AGCCTTATTTTAACTTGCT ATTT CTAGCTCTAAAAC Shiroshita et al. 1 N/A T7-sgRNA target Forward primer for GFP: ttaatacgactcactataGGGCGAGGAGCTGT TCACCGgttttagagctagaaatagc Shiroshita et al. 1 UBC-GFP Forward primer: GTTCACCTTGATGCCGTTCT Shiroshita et al.…”

Section: Key Resources Tablementioning

confidence: 99%

“… 1 N/A T7-sgRNA target Forward primer for GFP: ttaatacgactcactataGGGCGAGGAGCTGT TCACCGgttttagagctagaaatagc Shiroshita et al. 1 UBC-GFP Forward primer: GTTCACCTTGATGCCGTTCT Shiroshita et al. 1 N/A UBC-GFP Reverse and sequence primer: CACCCGTTCTGTTGGCTTAT Shiroshita et al.…”

Section: Key Resources Tablementioning

confidence: 99%

“… 1 UBC-GFP Forward primer: GTTCACCTTGATGCCGTTCT Shiroshita et al. 1 N/A UBC-GFP Reverse and sequence primer: CACCCGTTCTGTTGGCTTAT Shiroshita et al. 1 N/A Software and algorithms FlowJo version 10.7.2 Tree Star https://www.flowjo.com/solutions/flowjo SnapGene GLS Biotech https://www.snapgene.com/ Molecular Biology tool Benchling https://www.benchling.com TIDE Brinkman et al.…”

Section: Key Resources Tablementioning

confidence: 99%

See 2 more Smart Citations

Evaluating the function of murine quiescent hematopoietic stem cells following non-homologous end joining-based genome editing

2023

Self Cite

View full text Add to dashboard Cite

Context-dependent modification of PFKFB3 in hematopoietic stem cells promotes anaerobic glycolysis and ensures stress hematopoiesis

Watanuki

Kobayashi

Yamamoto

et al. 2024

eLife

Self Cite

View full text Add to dashboard Cite

Metabolic pathways are plastic and rapidly change in response to stress or perturbation. Current metabolic profiling techniques require lysis of many cells, complicating the tracking of metabolic changes over time after stress in rare cells such as hematopoietic stem cells (HSCs). Here, we aimed to identify the key metabolic enzymes that define metabolic differences between steady-state and stress conditions in HSCs and elucidate their regulatory mechanisms. Through quantitative 13C metabolic flux analysis of glucose metabolism using high-sensitivity glucose tracing and mathematical modeling, we found that HSCs activate the glycolytic rate-limiting enzyme phosphofructokinase (PFK) during proliferation and oxidative phosphorylation (OXPHOS) inhibition. Real-time measurement of adenosine triphosphate (ATP) levels in single HSCs demonstrated that proliferative stress or OXPHOS inhibition led to accelerated glycolysis via increased activity of PFKFB3, the enzyme regulating an allosteric PFK activator, within seconds to meet ATP requirements. Furthermore, varying stresses differentially activated PFKFB3 via PRMT1-dependent methylation during proliferative stress and via AMPK-dependent phosphorylation during OXPHOS inhibition. Overexpression of Pfkfb3 induced HSC proliferation and promoted differentiated cell production, whereas inhibition or loss of Pfkfb3 suppressed them. This study reveals the flexible and multilayered regulation of HSC metabolism to sustain hematopoiesis under stress and provides techniques to better understand the physiological metabolism of rare hematopoietic cells. Combined isotope tracing, mathematical modeling, and single cell ATP analysis enable high-resolution evaluation of blood cell metabolism. Under stress, HSCs quickly accelerate glycolysis to meet ATP demands and maintain hematopoiesis via context-dependent PFKFB3 activation.

show abstract

A culture platform to study quiescent hematopoietic stem cells following genome editing

Cited by 6 publications

References 95 publications

Context-Dependent Modification of PFKFB3 in Hematopoietic Stem Cells Promotes Anaerobic Glycolysis and Ensures Stress Hematopoiesis

Context-Dependent Modification of PFKFB3 in Hematopoietic Stem Cells Promotes Anaerobic Glycolysis and Ensures Stress Hematopoiesis

Evaluating the function of murine quiescent hematopoietic stem cells following non-homologous end joining-based genome editing

Context-dependent modification of PFKFB3 in hematopoietic stem cells promotes anaerobic glycolysis and ensures stress hematopoiesis

Contact Info

Product

Resources

About