A comparison of DNA and RNA quadruplex structures and stabilities

Joachimi, Astrid; Benz, Armin; Hartig, Jörg S.

doi:10.1016/j.bmc.2009.08.043

Cited by 190 publications

(208 citation statements)

References 44 publications

(73 reference statements)

Supporting

Mentioning

188

Contrasting

Unclassified

Order By: Relevance

“…The adenines replaced by 2AP to produce the fluorescently labeled Shank1a_18AP and Shank1b_242AP are bolded. Shank1a (nt 423-450) 18 5' GGGGUUGGGGAGGGUGUAGGGGGUGGGG 3' Shank1b (nt 452-481) 24 5' GGGGAGGAGAGGUCGGGGUGGGGAGUGGGG 3' Figure 1. 1 H NMR spectra of the imino proton region of Shank1a (A) and Shank1b (B) RNA in the presence of increasing concentrations of KCl in the range 0-50 mM.…”

Section: Resultsmentioning

confidence: 99%

“…17,18 G-quadruplex structures have been mostly found in mRNA untranslated regions (UTR), 3 0 UTR or 5 0 UTR, which are known to be involved in translational regulation, particularly of growth factors, transcription factors and onco-proteins, implying that the G-quadruplex plays a role in gene expression regulation at the mRNA level. [19][20][21] The G-quadruplex structure located in the 3 0 UTR has been proposed to act as a neurite localization signal of dendritic mRNAs, such as Shank1, PSD-95, CaMKIIa, dendrite and glycine receptor A1 subunit.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

FMRP interacts with G-quadruplex structures in the 3’-UTR of its dendritic target Shank1 mRNA

et al. 2014

View full text Add to dashboard Cite

Fragile X syndrome (FXS), the most common cause of inherited intellectual disability, is caused by the loss of expression of the fragile X mental retardation protein (FMRP). FMRP, which regulates the transport and translation of specific mRNAs, uses its RGG box domain to bind mRNA targets that form G-quadruplex structures. One of the FMRP in vivo targets, Shank1 mRNA, encodes the master scaffold proteins of the postsynaptic density (PSD) which regulate the size and shape of dendritic spines because of their capacity to interact with many different PSD components. Due to their effect on spine morphology, altered translational regulation of Shank1 transcripts may contribute to the FXS pathology. We hypothesized that the FMRP interactions with Shank1 mRNA are mediated by the recognition of the G quadruplex structure, which has not been previously demonstrated. In this study we used biophysical techniques to analyze the Shank1 mRNA 3'-UTR and its interactions with FMRP and its phosphorylated mimic FMRP S500D. We found that the Shank1 mRNA 3 0 -UTR adopts two very stable intramolecular G-quadruplexes which are bound specifically and with high affinity by FMRP both in vitro and in vivo. These results suggest a role of G-quadruplex RNA motif as a structural element in the common mechanism of FMRP regulation of its dendritic mRNA targets.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

FMRP interacts with G-quadruplex structures in the 3’-UTR of its dendritic target Shank1 mRNA

et al. 2014

View full text Add to dashboard Cite

show abstract

“…3 their DNA counterparts (Sacca et al 2005;Joachimi et al 2009;Halder and Hartig 2011;Zhang et al 2011). Moreover, RNA G-quadruplexes are restricted to adopting a parallel configuration caused by the stronger preference for an anticonformation of the glycosidic bond between the ribose and guanine moieties (Halder and Hartig 2011).…”

Section: Introductionmentioning

confidence: 99%

The folding of 5′-UTR human G-quadruplexes possessing a long central loop

Jodoin

Bauer

Garant

et al. 2014

RNA

View full text Add to dashboard Cite

G-quadruplexes are widespread four-stranded structures that are adopted by G-rich regions of both DNA and RNA and are involved in essential biological processes such as mRNA translation. They are formed by the stacking of two or more G-quartets that are linked together by three loops. Although the maximal loop length is usually fixed to 7 nt in most G-quadruplexpredicting software, it has already been demonstrated that artificial DNA G-quadruplexes containing two distal loops that are limited to 1 nt each and a central loop up to 30 nt long are likely to form in vitro. This report demonstrates that such structures possessing a long central loop are actually found in the 5 ′ -UTRs of human mRNAs. Firstly, 1453 potential G-quadruplex-forming sequences (PG4s) were identified through a bioinformatic survey that searched for sequences respecting the requirement for two 1-nt long distal loops and a long central loop of 2-90 nt in length. Secondly, in vitro in-line probing experiments confirmed and characterized the folding of eight candidates possessing central loops of 10-70 nt long. Finally, the biological effect of several G-quadruplexes with a long central loop on mRNA expression was studied in cellulo using a luciferase gene reporter assay. Clearly, the actual definition of G-quadruplex-forming sequences is too conservative and must be expanded to include the long central loop. This greatly expands the number of expected PG4s in the transcriptome. Consideration of these new candidates might aid in elucidating the potentially important biological implications of the G-quadruplex structure.

show abstract

“…Such a notable difference between melting temperatures confirms the influence of potassium concentration on the thermal stability of RNA G-quadruplexes. 22 On the other hand, comparison of melting temperatures of Q4 and intramolecular telomeric RNA sequences reported in the a Instituto de Química Física Rocasolano, CSIC, C/Serrano 119, 28006 Madrid, bibliography 17,18 suggests that the length of the sequence is not necessarily a factor that enhances thermal stability. Large scale synthesis and purification of long telomeric RNA were performed following previously described protocols 23 yielding enough amount of sample to acquire 1D H-NMR spectra.…”

mentioning

confidence: 99%

Mechanical unfolding of long human telomeric RNA (TERRA)

et al. 2013

View full text Add to dashboard Cite

We report the first single molecule investigation of TERRA molecules.By using optical-tweezers and other biophysical techniques, we have found that long RNA constructions of up to 25 GGGUUA repeats form higher order structures comprised of single parallel G-quadruplex blocks, which unfold at lower forces than their DNA counterparts.Telomeres are nucleoprotein structures that protect chromosome ends from being recognized as DNA breaks.1 Mammalian telomere DNA consists of long tandem arrays of double-stranded TTAGGG repeats that are maintained by the telomerase. 2 The 3 0 end of each telomere terminates in a G-rich single-stranded overhang (150-200 nucleotides) that is able to self-fold into G-quadruplexes. The demonstration of the in vivo presence of DNA G-quadruplexes at telomeres suggests that these non-canonical secondary structures have a role in telomere end-protection, and therefore in chromosome stability. 3,4 It has also been found that telomere end-binding proteins control the folding and unfolding of DNA G-quadruplexes in vitro 5 and in vivo. 4Telomeres are transcribed from the subtelomeric regions towards chromosome ends into telomeric repeat-containing RNA (TERRA). 6,7 These non-coding RNA molecules contain subtelomere-derived sequences and an average of 34 GGGUUA repeats at their 3 0 end.8 TERRA acts as a scaffold for the assembly of telomeric proteins involved in telomere maintenance and telomeric heterochromatin formation. 9,10 Importantly, there is also evidence for the presence of TERRA RNA G-quadruplexes in living cells. Here, we report the synthesis and purification of TERRA molecules up to 96nt (twice the largest molecule previously analyzed by NMR), a size similar to the endogenous nuclear TERRA 8 (see ESI †).We have also used optical-tweezers (OT) to study RNA molecules with different numbers of possible quadruplexes ranging from 1 (Q1) to 6 (Q6). CD spectra of the RNA sequence Q4 in 25 mM potassium phosphate pH 7 buffer showed a positive band at 260 nm and a negative band at 240 nm (Fig. 1a), the characteristic signature of parallel-stranded G-quadruplex conformations. This result is in agreement with previously reported observations showing that other telomeric RNA sequences are folded into parallel G-quadruplex structures both in sodium and potassium solutions. 12,13,[16][17][18][19][20] It is also important to mention that no band at 300 nm was observed for this long telomeric RNA as it was reported for 22-mer and 45-mer telomeric RNA in ammonium acetate buffer. 15 On the other hand, the normalized CD spectra of the bimolecular G-quadruplex formed by r(UAGGGUUAGGGU) and Q4 showed a similar shape and amplitude, which indicates that most of the Q4 molecules form four G-quadruplexes (Fig. 1b). 21Thermal stability of Q4 was also measured by recording CD melting curves. To test the influence of the potassium concentration on the thermal stability we performed the experiments in two different potassium-containing buffers (Fig. 1c). Melting temperatures of 65.5 1C and 72.5 1C were obtained in 2...

show abstract

A comparison of DNA and RNA quadruplex structures and stabilities

Cited by 190 publications

References 44 publications

FMRP interacts with G-quadruplex structures in the 3’-UTR of its dendritic target Shank1 mRNA

FMRP interacts with G-quadruplex structures in the 3’-UTR of its dendritic target Shank1 mRNA

The folding of 5′-UTR human G-quadruplexes possessing a long central loop

Mechanical unfolding of long human telomeric RNA (TERRA)

Contact Info

Product

Resources

About