A Cluster of Ring Stage–specific Genes Linked to a Locus Implicated in Cytoadherence inPlasmodium falciparumCodes for PEXEL-negative and PEXEL-positive Proteins Exported into the Host Cell

Abstract

Blood stages of Plasmodium falciparum export proteins into their erythrocyte host, thereby inducing extensive host cell modifications that become apparent after the first half of the asexual development cycle (ring stage). This is responsible for a major part of parasite virulence. Export of many parasite proteins depends on a sequence motif termed Plasmodium export element (PEXEL) or vacuolar transport signal (VTS). This motif has allowed the prediction of the Plasmodium exportome. Using published genome sequence, we redetermined the boundaries of a previously studied region linked to P. falciparum virulence, reducing the number of candidate genes in this region to 13. Among these, we identified a cluster of four ring stage-specific genes, one of which is known to encode an exported protein. We demonstrate that all four genes code for proteins exported into the host cell, although only two genes contain an obvious PEXEL/VTS motif. We propose that the systematic analysis of ring stage-specific genes will reveal a cohort of exported proteins not present in the currently predicted exportome. Moreover, this provides further evidence that host cell remodeling is a major task of this developmental stage. Biochemical and photobleaching studies using these proteins reveal new properties of the parasiteinduced membrane compartments in the host cell. This has important implications for the biogenesis and connectivity of these structures. INTRODUCTIONPlasmodium falciparum is the causative agent of the most severe form of human malaria, killing 1-2 million people each year (Snow et al., 2005). The symptoms of this disease are associated with the continuous asexual multiplication of P. falciparum parasites within red blood cells (RBCs) (for review, see Miller et al., 2002). In this part of the life cycle, the parasite develops, within 48 h from the ring stage, to the trophozoite stage and finally to the schizont stage after which the infected RBCs (IRBCs) rupture, releasing up to 32 merozoite stage parasites that infect new RBCs.The ring stage lasts for almost half of this cycle (ϳ0-20 h after invasion) and shows low metabolic activity with little change in size and morphology (Zolg et al., 1984;de Rojas and Wasserman, 1985). P. falciparum ring forms are the only stages apparent in the blood circulation of infected humans, because more mature parasites adhere to the endothelium of various organs to avoid clearance by the spleen (Langreth and Peterson, 1985). The subsequent accumulation of infected RBCs in the microvasculature is largely responsible for malaria-associated morbidity and mortality. This sequestration of IRBCs is mediated by the parasite protein P. falciparum erythrocyte membrane protein 1 (PfEMP-1), which is exported to the surface of the IRBCs and is encoded by a family of variant antigens (Baruch et al., 1995;Smith et al., 1995;Su et al., 1995). Because human RBCs are devoid of a functional protein trafficking system, the parasite has to establish a protein export system in the host cell before PfEMP-1 can b...

Development and host cell modifications of Plasmodium falciparum blood stages in four dimensions

“…In Bodipy TR C 5 ceramide stained REX2∆TM GFP expressing parasites it was detectable as a mem brane delineated area that lacked cytosolic GFP ( S3f). Parasites expressing GFP in the host cell cytosol (using the REX3 export motif 22,43 ) showed fluo rescence in the cavity (Fig. 4c), whereas a cell line expressing GFP in the PV (using the EXP1 signal peptide 44 ) showed staining simi lar to Bodipy TR C 5 ceramide (Fig.…”

“…The lack of detectable cleft formation from the early trophozoite onwards has important implications for protein export. It suggests that, at least after this stage, exported membrane proteins reach the clefts in other ways than through the formation of new clefts 2,17,18,22 . To confirm this, we used parasites expressing REX2 fused to the irre versibly photoconvertible protein Dendra2 (refs 46, 47).…”

“…In a similar concerted man ner, we find that segmentation of merozoites coincides with the time Maurer's clefts collapse, indicating active dismantling of host cell modifications to facilitate egress. It was proposed that parasite membrane proteins are exported to Maurer's clefts by insertion into nascent clefts at the PVM, linking cleft biogenesis and export 2,17,18,22 . Our data indicate that the total number of Maurer's clefts per infected cell is formed very early after invasion and remains constant until shortly before egress.…”

“…To export GFP into the host cell, we used the amino terminal part of REX3 (ref. 22) that is sufficient to mediate export 43 using primer REX3fwK 37 and reverse primer 5′ CAGCCCTAGGTTTTTTTAAATCCTGTTCTTCTACAAC 3′.…”

“…Maurer's clefts can be detected from the late ring stage onwards 5,15 and are thought to originate through budding from the PVM or from extensions of the PVM termed the tubove sicular network, their number increasing as the parasite progresses through the cycle 2,[16][17][18][19][20] . This forms the basis for one model that could solve a mechanistic problem in protein export in malaria parasites: although soluble proteins can pass through the recently described translocon at the PVM 21 , it was proposed that transmembrane pro teins are loaded into nascent Maurer's clefts forming at the PVM and are thereby exported with the new cleft 2,17,18,22,23 . Thus, according to this model, the export of these proteins depends on the continu ous genesis of clefts.…”