A Chimeric Protein Containing the N Terminus of the Adeno-Associated Virus Rep Protein Recognizes Its Target Site in an In Vivo Assay

Abstract

The Rep78 and Rep68 proteins of adeno-associated virus (AAV) type 2 are involved in DNA replication, regulation of gene expression, and targeting site-specific integration. They bind to a specific Rep recognition sequence (RRS) found in both the viral inverted terminal repeats and the AAVS1 integration locus on human chromosome 19. Previous in vitro studies implied that an N-terminal segment of Rep is involved in DNA recognition, while additional domains might stabilize binding and mediate multimerization. In order to define the minimal requirements for Rep to recognize its target site in the human genome, we developed one-hybrid assays in which DNA-protein interactions are detected in vivo. Chimeric proteins consisting of the N terminus of Rep fused to different oligomerization motifs and a transcriptional activation domain were analyzed for oligomerization, DNA binding, and activation of reporter gene expression. Expression of reporter genes was driven from RRS motifs cloned upstream of minimal promoters and examined in mammalian cells from transfected plasmids and in Saccharomyces cerevisiae from a reporter cassette integrated into the yeast genome. Our results show for the first time that chimeric proteins containing the amino-terminal 244 residues of Rep are able to target the RRS in vitro and in vivo when incorporated into artificial multimers. These studies suggest that chimeric proteins may be used to harness the unique targeting feature of AAV for gene therapy applications.Adeno-associated virus (AAV) type 2 is a nonpathogenic human parvovirus that relies upon a helper virus for efficient replication (5). Under conditions that are not permissive for replication, AAV infection results in integration of the viral genome into the host chromosome (6,30,44). A unique characteristic of AAV integration is that in human cell lines it can be targeted in about 70% of cases to a specific site on chromosome 19q13. 3-qter (24, 25, 45). The preintegration locus, termed AAVS1, has been cloned and sequenced (23). Sitespecific integration by AAV into the preintegration locus requires cis-acting sequences within the viral origin of replication and AAVS1 as well as the DNA-binding activity of the Rep proteins (31, 60). It would be particularly attractive to harness this unique targeting feature for gene transfer vehicles, since this would decrease the chances of insertional mutagenesis associated with random integration.The AAV genome is a single-stranded linear DNA molecule with inverted terminal repeats (ITRs) that fold into hairpin structures and serve as the origins for DNA replication (5). The ITR is involved in regulation of gene expression, initiation of DNA replication, packaging of the viral genome, site-specific integration, and rescue from the integrated state. The genome contains two open reading frames (ORFs) encoding nonstructural (Rep) and structural (Cap) proteins. Expression is regulated by three viral promoters, p5, p19, and p40. The rep gene encodes four overlapping multifunctional Rep proteins, named a...

Transcriptional Analysis of the Adeno-Associated Virus Integration Site

“…It is further noteworthy that the consensus binding site for the ubiquitously expressed ZF5 transcription factor (44) overlaps with the RBS (8,9,12) and is one of the most frequently occurring motifs within core promoter regions (4). However, the function and biological significance of ZF5 sites have not yet been elucidated.…”

The Adeno-Associated Virus Type 2 Rep Protein Regulates RNA Processing via Interaction with the Transcription Template

“…The GalBSP40VP and NS1BSP40VP plasmids were constructed by fusing three Gal4 binding site repeats (CGGAGTACTGTCCTCCG) (44) or the minute virus of mice (MVM) NS1 binding site (TTGGTTGGTAA AGAATGGTTACCAATCTACCA) (8), respectively, in front of the P40 promoter in P40VP. The Gal4VP16 chimeric expression plasmid (pSGVP) was described elsewhere (37), and the MVM NS1 expression plasmid pNS1, previously called pCMV1989, has also been previously described (29 (6).…”

A Functional Complex of Adenovirus Proteins E1B-55kDa and E4orf6 Is Necessary To Modulate the Expression Level of p53 but Not Its Transcriptional Activity

“…Cell lysates were assessed for production of late adenovirus proteins by being immunoblotted with a polyclonal serum (Fig. 1C) as previously described (7). Expression of E4orf6.WT was sufficient to complement Ad5 dl1014 for late protein expression, but E4orf6.AXA had lost this activity.…”

“…Total DNA quantity was kept constant by adding empty pcDNA vector (Invitrogen). Cells were harvested 32 h posttransfection, and lysates were analyzed for luciferase and ␤-galactosidase activities, as previously described (7,12). As shown in Fig.…”