A cell competition–based small molecule screen identifies a novel compound that induces dual c-Myc depletion and p53 activation

Abstract

Breakpoint Cluster Region-Abelson kinase (BCR–Abl) is a driver oncogene that causes chronic myeloid leukemia and a subset of acute lymphoid leukemias. Although tyrosine kinase inhibitors provide an effective treatment for these diseases, they generally do not kill leukemic stem cells (LSCs), the cancer-initiating cells that compete with normal hematopoietic stem cells for the bone marrow niche. New strategies to target cancers driven by BCR–Abl are therefore urgently needed. We performed a small molecule screen based on competition between isogenic untransformed cells and BCR–Abl-transformed cells and identified several compounds that selectively impair the fitness of BCR–Abl-transformed cells. Interestingly, systems-level analysis of one of these novel compounds, DJ34, revealed that it induced depletion of c-Myc and activation of p53. DJ34-mediated c-Myc depletion occurred in a wide range of tumor cell types, including lymphoma, lung, glioblastoma, breast cancer, and several forms of leukemia, with primary LSCs being particularly sensitive to DJ34. Further analyses revealed that DJ34 interferes with c-Myc synthesis at the level of transcription, and we provide data showing that DJ34 is a DNA intercalator and topoisomerase II inhibitor. Physiologically, DJ34 induced apoptosis, cell cycle arrest, and cell differentiation. Taken together, we have identified a novel compound that dually targets c-Myc and p53 in a wide variety of cancers, and with particularly strong activity against LSCs.

Regulated cell death (RCD) in cancer: key pathways and targeted therapies

“…A small-molecule compound, DJ34, was reported to inhibit the transcription of c-Myc and activate p53 protein to selectively and synergistically eliminate LSCs. 168 In human ovarian cancer, placenta-specific protein 1 (PLAC1) was overexpressed and could cause cell proliferation and metastasis. p53 inhibited PLAC1 transcription, while mutation of p53 attenuated this effect.…”

Phenotypic deconvolution in heterogeneous cancer cell populations using drug screening data

“…We tested monoclonal and mixture populations of isogenic Ba/F3 murine cell lines that were stably transformed with either the wild-type BCR-ABL fusion oncogene or with BCR-ABL-T315I, which contains a point mutation that confers increased resistance to the Abl tyrosine kinase inhibitor imatinib. Note that expression of these oncogenes renders cells addicted to BCR-ABL activity [20]. Monopopulations and mixtures of these two cell lines were treated with 11 different concentrations of imatinib, and the bulk cell population sizes were quantified at 14 time points.…”

“…BCR-Abl-T315I expressing plasmid was established by site-directed mutagenesis of p210 BCR-Abl (Addgene 27481) using QuickChange II XL (Agilent Technologies) with the forward primer 5’ GGGAGCCCCCGTTCTATATCATCATTGAGTTCATGACCTACG 3’ and the reverse primer 5’ CGTAGGTCATGAACTCAATGATGATATAGAACGGGGGCT CCC 3’ for T315I. To generate cells stably expressing BCR-Abl (imatinib-sensitive) and BCR-Abl-T315I (imatinib-resistant), parental Ba/F3 cells were transfected with the appropriate plasmids by electroporation using Amaxa biosystems nucleofecor II and stable cells were established by selecting with medium containing 500μg/ml Geneticin (Gibco, UK) and lacking the growth factor IL3 (BCR-ABL activity can overcome the requirement for IL3 of untransformed parental cells for survival/proliferation [20]). Furthermore, Ba/F3 cells expressing BCR-Abl were stably transfected with GFP expression, pRNAT-H1.1/Hygro plasmid from Genscript (Piscataway NJ, USA).…”

Decline of regenerative potential of old muscle stem cells: contribution to muscle aging

“…While the diversity of transcript isoforms has not been assessed in young compared to aged MuSCs, it would be interesting to study whether the MuSCs that are retained in the aging muscle are able to do so due to an increase in isoform diversity in certain genes. Finally, another potential driver of preferential stem cell population retention during aging may be due to cell-cell competition [210][211][212]. A recent demonstration of cell-cell competition in the context of aging involved COL17A1 + epidermal stem cells outcompeting COL17A1 À clones [211].…”