A CAF40-binding motif facilitates recruitment of the CCR4-NOT complex to mRNAs targeted by Drosophila Roquin

Sgromo, Annamaria; Raisch, Tobias; Bawankar, Praveen; Bhandari, Dipankar; Chen, Ying; Kuzuoğlu-Öztürk, Duygu; Weichenrieder, Oliver; Izaurralde, Elisa

doi:10.1038/ncomms14307

Cited by 80 publications

(122 citation statements)

References 56 publications

Supporting

Mentioning

118

Contrasting

Order By: Relevance

“…The CCR4-NOT complex can repress translation either through its associated deadenylation activity or through the DDX6 pathway acting at the 5’ end of mRNA 24,25 . Several CCR4-NOT associated E3 ligases have been reported to increase deadenylation activity leading to accelerated mRNA decay 47,49 . We therefore analysed the poly(A) tail length of RNF219-tethered reporter mRNA using the extension Poly(A) Test (ePAT) assay 35,50 .…”

Section: Resultsmentioning

confidence: 99%

RNF219 regulates CCR4-NOT function in mRNA translation and deadenylation

Guénolé

Velilla

Chartier³

et al. 2019

Preprint

View full text Add to dashboard Cite

Post-transcriptional regulatory mechanisms play a role in many biological contexts through the control of mRNA degradation, translation and localization. Here, we show that the uncharacterized RING finger protein RNF219 co-purifies and strongly associates with the CCR4-NOT complex, the major mRNA deadenylase in eukaryotes, that mediates translational repression in a deadenylase activity-dependent and -independent manner. Strikingly, although RNF219, inhibits the deadenylase activity of CCR4-NOT, it enhances its capacity to repress translation of a targeted mRNA, an effect of RNF219 that requires its interaction with CCR4-NOT. We propose that RNF219 is an interacting partner of the CCR4-NOT complex that switches the translational repressive activity of CCR4-NOT from a deadenylation-dependent to a deadenylation-independent mechanism. CCR4-NOT is recruited by RNA binding proteins (RBPs) or miRNAs to specific 3' untranslated regions (UTRs) in mRNAs under certain physiological conditions 16-21 , or during developmental processes 22,23 Besides its role in deadenylation-dependent mRNA decay, CCR4-NOT can regulate translation in a deadenylation-indeendent manner. In this pathway, the translation repressors DDX6 (p54/RCK) (yeast ortholog: Dhh1) and EIF4ENIF1 (4E-T) bind to the CCR4-NOT scaffold subunit CNOT1 24,25 . These proteins can activate the decapping machinery, which leads to translation inhibition, mRNA storage and/or mRNA degradation [26][27][28][29] .Here, we identify the heretofore uncharacterized C3HC4 RING domain dependent E3 Ubiquitin ligase RNF219, which stably binds the CCR4-NOT complex. We further show that RNF219 inhibits the expression and stabilizes the poly(A) tail of a targeted mRNA. Moreover, loss of RNF219 interaction with CCR4-NOT greatly abolishes these two activities.Hence, we propose that RNF219 may act as a molecular switch that enables CCR4-NOT to change function from deadenylation to deadenylation-independent translational repression. MATERIAL AND METHODS Cell cultureHEK293T, HeLa, and U2OS cells were grown in DMEM (Life Technologies) containing 10% FBS (Sigma-Aldrich) and 1% penicillin/streptomycin (Life Technologies). HEK293T and HeLa RNF219 CRISPR KO (HEK293T SG1-C and HeLa SG1-C) construct and cell lines were generated using Ran et al. published protocol 30 . The sequences used to generate the guide RNA are sgRNA_1F (CACCGCTATGCTAAGCCATACGGTC), sgRNA_1R (AAACGACCGTATGGCTTAGCATAG). Antibodies and reagentsAntibodies were obtained from Santa Cruz Biotechnology (Tubulin sc-5286, RPL3 sc-86828, p27 Antibody (F-8) sc-1641), Bethyl Laboratories (CNOT3 A302-156A, CNOT2 A302-562A, RNF219 A302-540A (RNF219-C)), Proteintech (CNOT1 14276-1-AP), Covance (anti-HA.11, MMS-101P) and Abcam (GAPDH ab9485). FLAG-M2 agarose (F2426 or A2220-5ML) and FLAG peptide (F3290-4MG) were purchased from Sigma-Aldrich. RNF219 specific antibodies were produced using an internal (RNF219-A) or C-terminal (RNF219-B) peptide by Abnova (Taiwan). Secondary antibodies were purchased from Cell Signaling Technology (goat anti...

show abstract

Section: Resultsmentioning

confidence: 99%

RNF219 regulates CCR4-NOT function in mRNA translation and deadenylation

Guénolé

Velilla

Chartier³

et al. 2019

Preprint

View full text Add to dashboard Cite

show abstract

“…Recruitment of CNOT by RNA-binding factors has emerged as an important mechanism of posttranscriptional regulation (39,45,(77)(78)(79)(80). Utilization of CNOT by Pum orthologs has been reported in Saccharomyces cerevisiae, Schizosaccharomyces pombe, Caenorhabditis elegans, Drosophila melanogaster and mammals (11,43,44,72,(81)(82)(83), and thus represents an evolutionarily conserved mechanism.…”

Section: Discussionmentioning

confidence: 99%

Unique repression domains of Pumilio utilize deadenylation and decapping factors to accelerate destruction of target mRNAs

Arvola

Chang

Buytendorp

et al. 2019

Preprint

View full text Add to dashboard Cite

Pumilio is an RNA-binding protein that represses a network of mRNAs to control embryogenesis, stem cell fate, fertility, and neurological functions in Drosophila. We sought to identify the mechanism of Pumilio-mediated repression and find that it accelerates degradation of target mRNAs, mediated by three N-terminal Repression Domains (RDs), which are unique to Pumilio orthologs. We show that the repressive activities of the Pumilio RDs depend on specific subunits of the Ccr4-Not (CNOT) deadenylase complex. Depletion of Pop2, Not1, Not2, or Not3 subunits alleviates Pumilio RD-mediated repression of protein expression and mRNA decay, whereas depletion of other CNOT components had little or no effect. Moreover, the catalytic activity of Pop2 deadenylase is important for Pumilio RD activity. Further, we show that the Pumilio RDs directly bind to the CNOT complex. We also report that the decapping enzyme, Dcp2, participates in repression by the N-terminus of Pumilio. These results support a model wherein Pumilio utilizes CNOT deadenylase and decapping complexes to accelerate destruction of target mRNAs. Because the N-terminal RDs are conserved in mammalian Pumilio orthologs, the results of this work broadly enhance our understanding of Pumilio function and roles in diseases including cancer, neurodegeneration, and epilepsy.

show abstract

“…RNA-binding proteins that interact with the mRNA decay machinery typically contain a canonical RNA-binding domain, and regions of low sequence complexity that are predicted to be structurally disordered (Jonas and Izaurralde, 2013). Short linear motifs within these regions can adopt secondary structure, and this may facilitate interaction with other proteins, including Ccr4-Not (Bhandari et al, 2014;Fabian et al, 2013;Raisch et al, 2016;Sgromo et al, 2017;Stowell et al, 2016). Recent work showed that Drosophila Nanos utilizes two short linear motifs to contact the NOT1 and NOT3 subunits of Ccr4-Not (Raisch et al, 2016).…”

Section: Ccr4-not Recruitment By Rna-binding Proteinsmentioning

confidence: 99%