A budding yeast model for human disease mutations in the EXOSC2 cap subunit of the RNA exosome complex

Abstract

RNA exosomopathies, a growing family of diseases, are linked to missense mutations in genes encoding structural subunits of the evolutionarily conserved, 10-subunit exoribonuclease complex, the RNA exosome. This complex consists of a 3-subunit cap, a 6-subunit, barrel-shaped, core and a catalytic base subunit. While a number of mutations in RNA exosome genes cause pontocerebellar hypoplasia, mutations in the cap subunit gene EXOSC2 cause an apparently distinct clinical presentation that has been defined as a novel syndrome SHRF (Short stature, Hearing loss, Retinitis pigmentosa and distinctive Facies). We generated the first in vivo model of the SHRF pathogenic amino acid substitutions using budding yeast by modeling pathogenic EXOSC2 missense mutations (p.Gly30Val and p.Gly198Asp) in the orthologous S. cerevisiae gene RRP4. The resulting rrp4 mutant cells show defects in cell growth and RNA exosome function. Consistent with altered RNA exosome function, we detect significant transcriptomic changes in both coding and non-coding RNAs in rrp4-G226D cells that model EXOSC2 p.Gly198Asp, suggesting defects in nuclear surveillance. Biochemical and genetic analyses suggest that the Rrp4 G226D variant subunit shows impaired interactions with key RNA exosome cofactors that modulate the function of the complex. These results provide the first in vivo evidence that pathogenic missense mutations present in EXOSC2 impair the function of the RNA exosome. This study also sets the stage to compare exosomopathy models to understand how defects in RNA exosome function underlie distinct pathologies.Words= 231

In vivoCharacterization of the Critical Interaction between the RNA Exosome and the Essential RNA Helicase Mtr4 inSaccharomyces cerevisiae

“…The mtr4-1 cells have a missense mutation in MTR4 that results in accumulation of polyadenylated targets within the nucleus (Kadowaki et al 1994;Kadowaki et al 1995;Liang et al 1996;Weir et al 2010). We detect increases in the steady-state level of both mature and precursor TLC1 in rrp4-M68T cells similar to that observed in rrp4-G226D cells (Figure 4A) (Sterrett et al 2021). Both mature and precursor TLC1 steady-state levels are significantly increased in mtr4-1 cells.…”

“…The rrp4-M68T LEU2 CEN6 (pAC4206) and rrp4-M68T-2xMyc LEU2 CEN6 (pAC4207) plasmids were generated by site-directed mutagenesis of the RRP4 (pAC3656) or RRP4-2xMyc (pAC3669) plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5'GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3', Rev 5'GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3') and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099) plasmid was generated as described previously (Sterrett et al 2021). Similarly, the other mtr4 mutant plasmids were constructed by site-directed mutagenesis of the MTR4 HIS CEN6 plasmid (pAC4096) with the QuikChange II Site-Directed Mutagenesis Kit (Agilent) and oligonucleotides containing the corresponding missense mutations.…”

“…We also measured the steady-state level of select targets that are impacted within rrp4-G226D cells (Sterrett et al 2021). We assessed the target INO1, which encodes inositol-3-phosphate synthetase (Donahue and Henry 1981;Klig and Henry 1984).…”

“…We assessed the target INO1, which encodes inositol-3-phosphate synthetase (Donahue and Henry 1981;Klig and Henry 1984). INO1 mRNA has previously been identified as a transcript bound to the catalytic subunit of the RNA exosome (Delan-Forino et al 2017), and was the most significantly decreased transcript in a previous RNA-Seq analysis of the rrp4-G226D cells (Sterrett et al 2021). In rrp4-M68T cells, the steady-state level of INO1 is significantly decreased, similar to results for rrp4-G226D (Figure 4D).…”

“…The sensitivity of the rrp4-M68T cells to drugs that impact RNA processing (Figure 3D) and the observed accumulation of key RNA exosome target RNAs (Figure 4) suggest that RNA exosome function may be impaired by the modeled multiple myeloma amino acid substitution. Previous studies suggest that SHRF-linked amino acid substitutions modeled in Rrp4 affect the RNA exosome function in part by disrupting complex integrity (Sterrett et al 2021). To assess the impact of the modeled multiple myeloma amino acid substitution on the association of Rrp4 with other RNA exosome core subunits, we first assayed the protein level of Rrp4 M68T.…”