A biotechnological approach to improving the nutritive value of alfalfa.

Abstract

The postruminal supply of the sulfur-containing amino acids, methionine and cysteine, has been reported to be a major limitation to wool growth in sheep. We aim to improve the protein quality of forage for ruminants by introducing into alfalfa chimeric genes encoding a ruminally stable, sulfur amino acid-rich protein from sunflower seeds. Four gene constructs were transferred to Australian commercial cultivars of alfalfa using Agrobacterium tumefaciens-mediated transformation and selection with phosphinothricin (PPT). Modification of the sunflower seed albumin protein-coding region by addition of the coding information for an endoplasmic reticulum (ER) retention signal was found to greatly increase the level to which the sulfur amino acid-rich protein accumulated in the leaves of transgenic alfalfa plants. The Cauliflower Mosaic Virus (CaMV) 35S promoter and two light-regulated plant gene promoter regions were compared for their ability to direct high-level expression of the introduced genes in alfalfa leaves. The highest expression of sunflower seed albumin was found in transformants bearing a gene incorporating the promoter from the Arabidopsis thaliana ats1A gene, which encodes the ribulose bisphosphate carboxylase small subunit. The highest level of sunflower seed albumin found in transgenic alfalfa leaves was estimated to constitute .1% of soluble leaf protein. This level of accumulation of the foreign protein would be predicted to supply an extra 40 mg of sulfur amino acids daily to sheep fed the modified forage. Published studies in which wool growth rates were significantly increased employed supplementation of approximately 1 to 2 g of sulfur amino acids daily.

Protein quality control along the route to the plant vacuole.

“…The assembly-defective A363 phaseolin, schematically represented in Figure 1, was subcloned into plasmid pDHA to allow constitutive expression driven by the cauliflower mosaic virus 35S promoter (Pedrazzini et al, 1994;Tabe et al, 1995) and was stably expressed in tobacco by Agrobacterium-mediated transformation. We previously determined that A363 expressed transiently in tobacco mesophyll protoplasts is correctly translocated into the ER lumen and glycosylated but remains monomeric and shows extensive interaction with BiP before being degraded (Pedrazzini et al, 1994).…”

A Relaxed Specificity in Interchain Disulfide Bond Formation Characterizes the Assembly of a Low-Molecular-Weight Glutenin Subunit in the Endoplasmic Reticulum

“…with oligonucleotides GGATATCTAGAAATGAAGACCTTCCTCGTC and CCGATATCCTGCAGTCAGTAGGCACCAACTCCGGTGCC. The amplification products were digested with XbaI and PstI and cloned in XbaI-PstI-cut pDHA (Tabe et al, 1995).…”

Sorting of Phaseolin to the Vacuole Is Saturable and Requires a Short C-Terminal Peptide

“…This could be considered as a more general, useful strategy when planning the expression of heterologous proteins of biotechnological interest in the plant secretory pathway. A strategy that has been successful in enhancing the stability of foreign vacuolar proteins is their accumulation in the ER via the KDEL /HDEL system normally used by soluble ER residents (Wandelt et al, 1992;Tabe et al, 1995;Khan et al, 1996). It would be interesting to compare accumulation in the ER versus the apoplast by using the same passenger proteins.…”

“…The construct thus lacks the last four residues of wildtype phaseolin (Ala, Phe, Val, and Tyr). ⌬418 was introduced into the vector pDHA (Tabe et al, 1995) for transient expression experiments. For constitutive expression in transgenic tobacco, pDHA containing ⌬418 was inserted into the HindIII site of the binary vector pGA470 , which was then used to transform Agrobacterium tumefaciens LBA4404 by electroporation.…”