A 6 kDa protein homologous to the N‐terminus of the HMG1 protein promoting stimulation of murine erythroleukemia cell differentiation

Sparatore, Bianca; Melloni, Edon; Patrone, Mauro; Passalacqua, Mario; Pontremoli, S.

doi:10.1016/0014-5793(96)00418-8

Cited by 9 publications

(8 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The sense primer was 5′‐CTGGCACATCTCCCAGAATGAG‐3′ (nucleotides 1–22); the antisense primer was 5′‐TCAAAAGTCACCATCCACCAGC‐3′ (complementary to nucleotides 1867–1888). PCR was carried out using AmpliTaq DNA polymerase (Perkin Elmer) and 30 cycles of amplification as previously described [27]. An aliquot (2 μl) of the reaction mixture was then used for cloning with the pGEM‐T Vector System (Promega) as specified by the manufacturer.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Rat brain contains multiple mRNAs for calpastatin¹

et al. 1998

Self Cite

View full text Add to dashboard Cite

This work was undertaken to establish the forms of the calpain inhibitor, calpastatin, expressed in the brain tissue. Five cDNA clones were obtained and the corresponding amino acid sequences were deduced. Three of these proteins contain an N-terminal domain (domain L) and four inhibitory repeats typical of the calpastatin molecule. The other two are truncated forms, containing the domain L, free or associated with a single inhibitory repeat. Other differences, due to exon skipping, produce calpastatin forms with different susceptibility to posttranslational modifications. The more represented mRNA form corresponds to a calpastatin molecule containing the four inhibitory domains. These results may be useful to understand the involvement of calpain in the onset of acute and degenerative disorders of the central nervous system. z 1998 Federation of European Biochemical Societies.

show abstract

Section: Methodsmentioning

confidence: 99%

“…Total RNA was isolated from Sprague-Dawley rat brains by extraction with guanidinium thiocyanate [26] and cDNA was synthesized using MMLV reverse transcriptase (Promega) as described [27]. The primers for PCR were selected externally to the translated sequence of rat liver cDNA for calpastatin (accession number X56729).…”

Section: Rna Isolation and Cdna Synthesismentioning

confidence: 99%

Rat brain contains multiple mRNAs for calpastatin¹

et al. 1998

Self Cite

View full text Add to dashboard Cite

show abstract

“…These receptors involved in HMGB1-mediated MEL cell differentiation include the ionotropic glutamate N-methyl-D-aspartate receptor (NMDAR) and unknown 65 kD protein, but not RAGE (Pedrazzi et al, 2012; Sparatore et al, 2002). Structurally, the N-terminal region of HMGB1 is responsible for promoting MEL cell differentiation (Sparatore et al, 1996a). A peptide from extracellular HMGB1 maintains the differentiation stimulatory activity of the whole protein by limited proteolysis (Sparatore et al, 2001).…”

Section: Hmgb1 Functionmentioning

confidence: 99%

HMGB1 in health and disease

Kang

Chen

Zhang

et al. 2014

Molecular Aspects of Medicine

801

828

View full text Add to dashboard Cite

Complex genetic and physiological variations as well as environmental factors that drive emergence of chromosomal instability, development of unscheduled cell death, skewed differentiation, and altered metabolism are central to the pathogenesis of human diseases and disorders. Understanding the molecular bases for these processes is important for the development of new diagnostic biomarkers, and for identifying new therapeutic targets. In 1973, a group of non-histone nuclear proteins with high electrophoretic mobility was discovered and termed High-Mobility Group (HMG) proteins. The HMG proteins include three superfamilies termed HMGB, HMGN, and HMGA. High-mobility group box 1 (HMGB1), the most abundant and well-studied HMG protein, senses and coordinates the cellular stress response and plays a critical role not only inside of the cell as a DNA chaperone, chromosome guardian, autophagy sustainer, and protector from apoptotic cell death, but also outside the cell as the prototypic damage associated molecular pattern molecule (DAMP). This DAMP, in conjunction with other factors, thus has cytokine, chemokine, and growth factor activity, orchestrating the inflammatory and immune response. All of these characteristics make HMGB1 a critical molecular target in multiple human diseases including infectious diseases, ischemia, immune disorders, neurodegenerative diseases, metabolic disorders, and cancer. Indeed, a number of emergent strategies have been used to inhibit HMGB1 expression, release, and activity in vitro and in vivo. These include antibodies, peptide inhbitiors, RNAi, anti-coagulants, endogenous hormones, various chemical compounds, HMGB1-receptor and signaling pathway inhibition, artificial DNAs, physical strategies including vagus nerve stimulation and other surgical approaches. Future work further investigating the details of HMGB1 localizationtion, structure, post-translational modification, and identifccation of additional partners will undoubtedly uncover additional secrets regarding HMGB1’s multiple functions.

show abstract

“…A series of studies have suggested an important role for extracellular amphoterin in erythroleukaemia cell differentiation [10–12, 24]. A 6‐kDa N‐terminal fragment [25] and a proteolytically processed short peptide (residues 130–139; [26]) of amphoterin are responsible for amphoterin‐induced differentiation of erythroleukaemia cells. In neural tissues amphoterin expression seems to correlate with an undifferentiated cell stage and early maturation [14–17].…”

Section: Introductionmentioning

confidence: 99%

Amphoterin as an extracellular regulator of cell motility: from discovery to disease

Huttunen

Rauvala

2004

Journal of Internal Medicine

157

128

View full text Add to dashboard Cite

Abstract. Huttunen HJ, Rauvala H (University of Helsinki, Helsinki, Finland). Amphoterin as an extracellular regulator of cell motility: from discovery to disease (Minisymposium). Amphoterin is a ubiquitous and highly conserved protein previously considered solely as a chromatinassociated, nuclear molecule. Amphoterin is released into the extracellular space by various cell types, and plays an important role in the regulation of cell migration, differentiation, tumorigenesis and inflammation. This paper reviews recent research on the mechanistic background underlying the biology of secreted amphoterin, with an emphasis on the role of amphoterin as an autocrine/paracrine regulator of cell migration.

show abstract

A 6 kDa protein homologous to the N‐terminus of the HMG1 protein promoting stimulation of murine erythroleukemia cell differentiation

Cited by 9 publications

References 18 publications

Rat brain contains multiple mRNAs for calpastatin¹

Rat brain contains multiple mRNAs for calpastatin¹

HMGB1 in health and disease

Amphoterin as an extracellular regulator of cell motility: from discovery to disease

Contact Info

Product

Resources

About

A 6 kDa protein homologous to the N‐terminus of the HMG1 protein promoting stimulation of murine erythroleukemia cell differentiation

Cited by 9 publications

References 18 publications

Rat brain contains multiple mRNAs for calpastatin1

Rat brain contains multiple mRNAs for calpastatin1

HMGB1 in health and disease

Amphoterin as an extracellular regulator of cell motility: from discovery to disease

Contact Info

Product

Resources

About

Rat brain contains multiple mRNAs for calpastatin¹

Rat brain contains multiple mRNAs for calpastatin¹