Untitled

Abstract

The promoter of a gene encoding a ribosome-associated protein of 40 kDa from Arabidopsis thaliana (A-p40) was sequenced and the expression of the gene studied. A-p40 was expressed in the same organs and with the same variations as the eukaryotic elongation factor 1 alpha (eEF1A), another gene coding for a protein involved in translation Arabidopsis plants transformed with a beta-glucuronidase (GUS) gene driven by the A-p40 promoter confirm that A-p40 is expressed in actively dividing and growing cells. eEF1A promoter-GUS fusions have the same pattern of expression. Comparison of cis-acting elements from A-p40 and eEF1A revealed some common elements. A-p40 promoter deletions and transient gene expression in transfected Arabidopsis protopasts allowed the identification of trap40, a cis-acting element regulating gene expression. Gel retardation experiments indicate that eEF1A and A-p40 are regulated by different cis-acting elements. The role of such elements is discussed.

In synergy with various cis‐acting elements, plant insterstitial telomere motifs regulate gene expression in Arabidopsis root meristems

“…The trap40 ‐box is a cis ‐acting element involved in the activation of the Arabidopsis Ap40 gene, encoding an acidic ribosomal protein [15]. This box presents similarities to the tef ‐box found in the eEF1A gene promoter.…”

“…2A) constructs. A Xba I– Cla I fragment containing a trap40 ‐box (in bold) (5′‐CTAGATTAAAAT TTGGGTAACCGAGTTTGGGGGTAGAATAGACA TTTTGCAAT‐3′) from the Arabidopsis thaliana Ap40 gene promoter [15] was introduced in the Telo and ΔTelo constructs, in position −77 upstream of the transcription initiation site, to obtain the Trap‐Telo and the Trap‐ΔTelo constructs (Fig. 2B).…”

Distribution of short interstitial telomere motifs in two plant genomes: putative origin and function

“…However, by itself this motif is not able to activate the transcription by RNA pol II but acts in synergy with various cis -acting elements to increase the expression. These cis -acting elements include the TEF1 box identified in promoters of the translation elongation factor EF1α[14], the Trap1 box in the promoter of a rp gene [15] and redundant site II motifs initially characterized in the promoter of the proliferating cellular nuclear antigen gene (PCNA) [16] and subsequently in most Arabidopsis rp genes [11]. …”

Expression analysis of Arabidopsis XH/XS-domain proteins indicates overlapping and distinct functions for members of this gene family

“…We then asked whether or not differences in FDM reporter localization could result from differences in expression levels, and fused both FDM–VENUS expression cassettes to the strong ribosomal protein RP40 promoter (Scheer et al , 1997) and analysed expression of the resultant reporter constructs in wild-type Col-0. Ectopic overexpression of both transgenes confirmed the results obtained with endogenous reporters, with RP40p::FDM1:VENUS root meristems exhibiting signals in nuclei, whereas RP40p::FDM5:VENUS signals were most pronounced in the cytoplasm (Fig.…”

“…Expression cassettes were cloned into a derivative of pPZP221 modified with the 35S terminator sequence (Hajdukiewicz et al , 1994; Leitner et al , 2012). For FDM1– and FDM5 –VENUS reporters, a VENUS cassette was fused to the 3′ end of the respective coding regions of cDNAs, and the resulting constructs were either expressed under the control of the RP40 promoter (Scheer et al , 1997) or by endogenous FDM promoters (as was used for promoter–GUS constructs). For overexpression constructs, expression cassettes were cloned 3′ of an RP40 promoter fragment, which was generated by PCR with primers 5′-GGGAATTCCTGGAGATATATCGGGTAAAGATGG-3′ and 5′-GGGAATTCTATCTCTCTTCTTCTTCTTCGCCGGGAA-3′.…”