Untitled

Bovis, Béatrice de; Derouet, Damien; Gauchat, Jean‐François; Elson, Greg; Gascan, Hugues; deLapeyrière, Odile

doi:10.1186/1478-811x-3-1

Cited by 14 publications

(6 citation statements)

References 15 publications

(18 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Furthermore our findings demonstrated that these cytokines also share a similar protein expression pattern in the rat fetal lung and, that for the most part of pulmonary development, gp130 cytokines expression is highly associated with both proximal and distal airways. This is found to be in agreement with further evidences that showed OSM [23] and CLC [25] expression in the pulmonary airway epithelium. It is also demonstrated that gp130 receptor protein is present in embryonic mesenchyme since early pulmonary development, and as gestation progresses its expression is predominantly associated with the developing epithelium, similarly to both the expression patterns observed for gp130 cytokines and LIFR in lung development [4].…”

Section: Discussionsupporting

confidence: 93%

“…Several evidences point towards a role of these inflammatory cytokines in varied aspects of lung physiology. During development, CLC is expressed in lung, particularly in distal airway epithelium, as well as several other organs [47], suggesting important biological roles of this cytokine. In opposition to lung growth inhibition here demonstrated, during kidney development (also a branching organ), CLC promotes mesenchymal to epithelial conversion and nephrogenesis [28].…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

The Role of Glycoprotein 130 Family of Cytokines in Fetal Rat Lung Development

et al. 2013

View full text Add to dashboard Cite

The glycoprotein 130 (gp130) dependent family of cytokines comprises interleukin-6 (IL-6), IL-11, leukemia inhibitory factor (LIF), cardiotrophin-like cytokine (CLC), ciliary neurotrophic factor (CNTF), cardiotrophin-1 (CT-1) and oncostatin M (OSM). These cytokines share the membrane gp130 as a common signal transducer. Recently, it was demonstrated that IL-6 promotes, whereas LIF inhibits fetal lung branching. Thus, in this study, the effects on fetal lung morphogenesis of the other classical members of the gp130-type cytokines (IL-11, CLC, CNTF, CT-1 and OSM) were investigated. We also provide the first description of these cytokines and their common gp130 receptor protein expression patterns during rat lung development. Fetal rat lung explants were cultured in vitro with increasing concentrations of IL-11, CLC, CNTF, CT-1 and OSM. Treated lung explants were morphometrically analyzed and assessed for MAPK, PI3K/AKT and STAT3 signaling modifications. IL-11, which similarly to IL-6 acts through a gp130 homodimer receptor, significantly stimulated lung growth via p38 phosphorylation. On the other hand, CLC, CNTF, CT-1 and OSM, whose receptors are gp130 heterodimers, inhibited lung growth acting in different signal-transducing pathways. Thus, the present study demonstrated that although cytokines of the gp130 family share a common signal transducer, there are specific biological activities for each cytokine on lung development. Indeed, cytokine signaling through gp130 homodimers stimulate, whereas cytokine signaling through gp130 heterodimers inhibit lung branching.

show abstract

Section: Discussionsupporting

confidence: 93%

Section: Discussionmentioning

confidence: 99%

The Role of Glycoprotein 130 Family of Cytokines in Fetal Rat Lung Development

et al. 2013

View full text Add to dashboard Cite

show abstract

“…However, CLF-1, alone or in combination with CNTFRα, has no direct impact on signaling, and so far its only know function is to facilitate transport and secretion of CLC. As previously described, CLC is expressed in the biosynthetic pathway but seems to depend on coexpression and complex formation with CLF-1 (or possibly CNTFRα) for cellular release ( 4 , 39 , 45 ). The clinical manifestations of CLF-1 deficiency have therefore been ascribed to the resulting decrease in CLC secretion.…”

Section: Discussionmentioning

confidence: 69%

“…CLC and CLF-1 are (co)expressed in a large number of cell types both inside and outside the nervous system ( 39 ), and, like CNTF, the CLC:CLF-1 heterodimer as well as the individual CLC subunit promotes growth and survival of CNTFRα-expressing neuronal cells ( 5 , 11 , 40 ). In the presence of CNTFRα (membrane anchored or soluble), CLC is sufficient to induce signaling, whereas CLF-1, as exemplified in the results shown in Fig.…”

Section: Discussionmentioning

confidence: 99%

Cytokine-Like Factor 1, an Essential Facilitator of Cardiotrophin-Like Cytokine:Ciliary Neurotrophic Factor Receptor α Signaling and sorLA-Mediated Turnover

Larsen

Kristensen

Pallesen

et al. 2016

Molecular and Cellular Biology

View full text Add to dashboard Cite

Cardiotrophin-like cytokine:cytokine-like factor-1 (CLC:CLF-1) is a heterodimeric neurotropic cytokine that plays a crucial role during neuronal development. Mice lacking CLC:CLF-1 die soon after birth due to a suckling defect and show reduced numbers of motor neurons. Humans carrying mutations in CLC:CLF-1 develop similar disorders, known as Sohar-Crisponi or cold-induced sweating syndrome, and have a high risk of early death. It is well known that CLC binds the ciliary neurotrophic factor receptor α (CNTFRα) and is a prerequisite for signaling through the gp130/leukemia inhibitory factor receptor β (LIFRβ) heterodimer, whereas CLF-1 serves to promote the cellular release of CLC. However, the precise role of CLF-1 is unclear. Here, we report that CLF-1, based on its binding site for CLC and on two additional and independent sites for CNTFRα and sorLA, is a key player in CLC and CNTFRα signaling and turnover. The site for CNTFRα enables CLF-1 to promote CLC:CNTFRα complex formation and signaling. The second site establishes a link between the endocytic receptor sorLA and the tripartite CLC:CLF-1:CNTFRα complex and allows sorLA to downregulate the CNTFRα pool in stimulated cells. Finally, sorLA may bind and concentrate the tripartite soluble CLC:CLF-1:CNTFRα complex on cell membranes and thus facilitate its signaling through gp130/LIFRβ.

show abstract

“…Nespas SYBR primers are exon 1 fwd: AGATTTCATTTCCCAGAGATGCT; exon 2 rev: GGTTAGGCAGATCCGACTTGT. Gnasxl , Exon1A , and Gapdh SYBR primers were described previously (de Bovis et al 2005; Eaton et al 2012). …”

Section: Methodsmentioning

confidence: 99%

Maternal inheritance of the Gnas cluster mutation Ex1A-T affects size, implicating NESP55 in growth

et al. 2013

View full text Add to dashboard Cite

Genes subjected to genomic imprinting are often associated with prenatal and postnatal growth. Furthermore, it has been observed that maternally silenced/paternally expressed genes tend to favour offspring growth, whilst paternally silenced/maternally expressed genes will restrict growth. One imprinted cluster in which this has been shown to hold true is the Gnas cluster; of the three proteins expressed from this cluster, two, Gsα and XLαs, have been found to affect postnatal growth in a number of different mouse models. The remaining protein in this cluster, NESP55, has not yet been shown to be involved in growth. We previously described a new mutation, Ex1A-T, which upon paternal transmission resulted in postnatal growth retardation due to loss of imprinting of Gsα and loss of expression of the paternally expressed XLαs. Here we describe maternal inheritance of Ex1A-T which gives rise to a small but highly significant overgrowth phenotype which we attribute to reduction of maternally expressed NESP55.

show abstract

Untitled

Cited by 14 publications

References 15 publications

The Role of Glycoprotein 130 Family of Cytokines in Fetal Rat Lung Development

The Role of Glycoprotein 130 Family of Cytokines in Fetal Rat Lung Development

Cytokine-Like Factor 1, an Essential Facilitator of Cardiotrophin-Like Cytokine:Ciliary Neurotrophic Factor Receptor α Signaling and sorLA-Mediated Turnover

Maternal inheritance of the Gnas cluster mutation Ex1A-T affects size, implicating NESP55 in growth

Contact Info

Product

Resources

About