[8] Enhanced translational efficiency with two-cistron expression system

Schoner, Brigitte E.; Belagaje, Rama M.; Schoner, Ronald G.

doi:10.1016/0076-6879(90)85010-l

Cited by 58 publications

(25 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although this 28-aminoacid fragment is highly conserved in the large-subunit homolog from S. pombe (pU2AF 59 ) (Fig. 3) (18), it was found to be necessary but not sufficient for interaction with the S. pombe small-subunit homolog (pU2AF 23 ) (32) in the yeast two-hybrid assay. A truncation of pU2AF 59 that retained the linker was not sufficient for interaction with pU2AF 23 .…”

Section: Discussionmentioning

confidence: 99%

“…3) (18), it was found to be necessary but not sufficient for interaction with the S. pombe small-subunit homolog (pU2AF 23 ) (32) in the yeast two-hybrid assay. A truncation of pU2AF 59 that retained the linker was not sufficient for interaction with pU2AF 23 . However, since the expression level of this truncated protein was not examined, it is difficult to interpret this negative result.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Interaction between Subunits of Heterodimeric Splicing Factor U2AF Is Essential In Vivo

Rudner

Kanaar

Breger

et al. 1998

Molecular and Cellular Biology

View full text Add to dashboard Cite

The heterodimeric pre-mRNA splicing factor, U2AF (U2 snRNP auxiliary factor), plays a critical role in 3 splice site selection. Although the U2AF subunits associate in a tight complex, biochemical experiments designed to address the requirement for both subunits in splicing have yielded conflicting results. We have taken a genetic approach to assess the requirement for the Drosophila U2AF heterodimer in vivo. We developed a novel Escherichia coli copurification assay to map the domain on the Drosophila U2AF large subunit (dU2AF 50 ) that interacts with the Drosophila small subunit (dU2AF 38 ). A 28-amino-acid fragment on dU2AF 50 that is both necessary and sufficient for interaction with dU2AF 38 was identified. Using the copurification assay, we scanned this 28-amino-acid interaction domain for mutations that abrogate heterodimer formation. A collection of these dU2AF50 point mutants was then tested in vivo for genetic complementation of a recessive lethal dU2AF 50 allele. A mutation that completely abolished interaction with dU2AF 38 was incapable of complementation, whereas dU2AF 50 mutations that did not effect heterodimer formation rescued the recessive lethal dU2AF 50 allele. Analysis of heterodimer formation in embryo extracts derived from these interaction mutant lines revealed a perfect correlation between the efficiency of subunit association and the ability to complement the dU2AF 50 recessive lethal allele. These data indicate that Drosophila U2AF heterodimer formation is essential for viability in vivo, consistent with a requirement for both subunits in splicing in vitro.Generation of functional mRNA in eukaryotes requires the removal of noncoding sequences (introns) from pre-mRNA by a process termed RNA splicing (17, 24). Pre-mRNA splicing takes place in the spliceosome, a dynamic RNA-protein complex that assembles in a stepwise, ATP-dependent manner on the pre-mRNA (13, 17). The spliceosome is composed of small nuclear ribonucleoprotein particles (snRNPs) and extrinsic (non-snRNP) protein factors. The earliest steps in spliceosome assembly involve the specification of the exon and intron boundaries by U1 and U2 snRNP. U1 snRNP binds the 5Ј splice site, and U2 snRNP binds the branch site sequence (13,17,19). Since in most cases the first AG dinucleotide downstream of the branch site is used as the 3Ј splice site, U2 snRNP defines the 3Ј splice site (20,27). The branch site sequence in metazoan introns is highly degenerate and is not sufficient for U2 snRNP recognition (22). Targeting of U2 snRNP to the branch site requires the extrinsic protein factor U2AF (U2 snRNP auxiliary factor). U2AF binds site specifically to the intron pyrimidine tract located between the branch point sequence and the 3Ј splice site and recruits U2 snRNP to the branch site at an early step in spliceosome assembly (22,36). Regulation of 3Ј splice site choice, both positive and negative, can be modulated by U2AF binding to the intron pyrimidine tract (3,6,17). Thus, U2AF is a major determinant in 3Ј splice site selection.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Interaction between Subunits of Heterodimeric Splicing Factor U2AF Is Essential In Vivo

Rudner

Kanaar

Breger

et al. 1998

Molecular and Cellular Biology

View full text Add to dashboard Cite

show abstract

“…All proteins were expressed and purified from a prokaryotic expression system. The protein coding sequence was expressed in Escherichia coli BL21::pLysE cells by using the pRSETA vector (Invitrogen) containing a T7 promoter and an upstream eight-amino-acid cistron (32). Bacteria containing the expression construct were grown at 37ЊC, and protein expression was induced with 0.1 mM isopropyl-␤-D-thiogalactopyranoside (IPTG) when the cells reached an optical density at 600 nm of 0.5.…”

Section: Methodsmentioning

confidence: 99%

“…The PCR fragments were gel purified and subcloned into the pRSETA vector (Invitrogen). To maximize protein expression, an upstream eight-amino-acid cistron corresponding to the nucleotide sequence ATGTATCGATTAAATAAGGAG GAATAA was cloned upstream of our gene (32). Site-directed mutagenesis of the amino acids in the leucine zipper motif were introduced by using oligonucleotides containing the mutations of interest and uracil-substituted single-stranded DNA essentially as previously described (13).…”

Section: Methodsmentioning

confidence: 99%

The Drosophila P-Element KP Repressor Protein Dimerizes and Interacts with Multiple Sites on P-Element DNA

Lee

Mul

Rio

1996

Molecular and Cellular Biology

106

View full text Add to dashboard Cite

Drosophila P elements are mobile DNA elements that encode an 87-kDa transposase enzyme and transpositional repressor proteins. One of these repressor proteins is the 207-amino-acid KP protein which is encoded by a naturally occurring P element with an internal deletion. To study the molecular mechanisms by which KP represses transposition, the protein was expressed, purified, and characterized. We show that the KP protein binds to multiple sites on the ends of P-element DNA, unlike the full-length transposase protein. These sites include the high-affinity transposase binding site, an 11-bp transpositional enhancer, and, at the highest concentrations tested, the terminal 31-bp inverted repeats. The DNA binding domain was localized to the N-terminal 98 amino acids and contains a CCHC sequence, a potential metal binding motif. We also demonstrate that the KP repressor protein can dimerize and contains two protein-protein interaction regions and that this dimerization is essential for high-affinity DNA binding.P-element transposons are mobile DNA elements found in many Drosophila melanogaster strains and have been used extensively as molecular genetic tools (9,25,26). The biological effects of P elements were initially observed in crosses between laboratory fly strains (M strains), which lack functional P elements, and those isolated from natural populations (P strains), which carry active P elements. When a P-strain female is crossed to either an M-strain male or a P-strain male, the progeny are healthy, with a wild-type germ line. However, when an M-strain female is crossed to a P-strain male, the progeny exhibit a series of genetic disorders in the germ line, such as chromosomal rearrangements, mutations, and sterility, collectively referred to as hybrid dysgenesis. It was later discovered that the causative agent of hybrid dysgenesis is the P-element transposon (5, 31). These observations indicate that P elements introduced by a P strain male into the egg of an M strain female mobilize in the germ line of the developing embryo and cause hybrid dysgenesis. In contrast, a P strain female maternally deposits P-element-encoded repressor proteins in her eggs that repress the mobilization of any P elements introduced by the male. This state of repression in P strain females has been termed the P cytotype. Although genetically well characterized, the molecular mechanisms of P-cytotype repression are not known.The P-element transposon contains several sequence elements at its termini that are essential in cis for transposition (Fig. 1A). The transposase binding site contains a 10-bp consensus sequence and is internally located at each end of the P element (10). Interaction between this site and the transposase protein is essential for transposition (10,21). A terminal 31-bp inverted repeat located at each end of the transposon is also necessary for mobilization and is recognized by a Drosophila host protein, IRBP (inverted repeat binding protein) (4,21,28). Finally, there is an internally located 11-bp inverted repeat t...

show abstract

“…Second, an intercistronic region including a polyhistidine tag, a ribosome binding site (Shine-Dalgarno sequence), and a stop codon was appended after the SH2 domain of the Fyn PTK (after Cys-246) by a single step PCR reaction using appropriate oligonucleotides. The intercistronic sequence was based on the sequence described by Shoner et al (21) and was utilized to allow the ribosome to start translating the second cistron encoding hNMT. The FynSH432His 6 SD DNA fragment was gel purified (22) and fused to hNMT cDNA by PCR using the splicing by overlap extension methodology (23,24).…”

Section: Reagents-fattymentioning

confidence: 99%

Biochemical Characterization of a Palmitoyl Acyltransferase Activity That Palmitoylates Myristoylated Proteins

Berthiaume

Resh

1995

Journal of Biological Chemistry

146

103

View full text Add to dashboard Cite

Dynamic regulation of signal transduction by reversible palmitoylation-depalmitoylation cycles has been recently described. However, further understanding of fatty acylation reactions has been hampered by our lack of knowledge about the specific transferases and thioesterases involved. Here, we describe an assay for the palmitoyl acyltransferase (PAT) that palmitoylates "myrGlyCys" containing members of the Src family of protein tyrosine kinases (PTKs Modification of proteins by fatty acids greatly alters their structure, function, and subcellular localization and has recently been shown to be involved in several aspects of cellular signaling (see Refs. 1 and 2 for recent reviews). More than 200 proteins are known to be fatty acylated, including viral and cellular proteins (1-3). Roles for protein fatty acylation range from anchoring proteins to membranes (3, 4) and stabilizing protein-protein interactions (5) to regulating enzymatic activities in mitochondria (6). In general, mutations that prevent fatty acylation abolish or greatly alter the biological function of these proteins.Protein fatty acylation can be divided into two categories: myristoylation and palmitoylation. N-Myristoylation involves the cotranslational attachment of the 14-carbon fatty acid myristate onto an N-terminal glycine residue of a protein via an amide linkage. Due to the high stability of this amide bond, myristoylation is irreversible, with some exceptions (7). The enzymology of N-myristoylation has been well characterized (Ref. 8 and references therein). A methionyl aminopeptidase first removes the initiator methionine. N-Myristoyl transferase (NMT) 1 then catalyzes the transfer of myristate to the glycine residue in position two. This glycine residue is an essential element of the substrate recognition sequence, since its substitution by any other amino acid within a protein prevents myristoylation.Many proteins contain the 16-carbon fatty acid palmitate attached to specific cysteine residues. In contrast to myristoylation, palmitoylation occurs post-translationally and is readily reversible. The enzymology of palmitoylation is not well characterized, and a palmitoyl acyltransferase (PAT) has not yet been isolated. No apparent consensus sequence has been found at the palmitoylation site, suggesting the presence of more than one type of PAT. However, the N termini of 7 of 9 members of the Src family of PTKs and several of the ␣ subunits of the heterotrimeric G proteins contain the sequence myrGlyCys, where Cys-3 is palmitoylated (2, 3). In most of these cases, myristoylation has been shown to be a prerequisite for palmitoylation to occur (9, 10).Many signal-transducing proteins translocate reversibly between plasma membrane and cytosol (1, 2). Several have been shown to be reversibly palmitoylated, such as ␣ subunits of G proteins and nitric oxide synthase. These proteins undergo agonist-stimulated palmitate turnover (11,12), suggesting that dynamic palmitoylation of proteins can regulate signal transduction.Little is known about the...

show abstract

[8] Enhanced translational efficiency with two-cistron expression system

Cited by 58 publications

References 18 publications

Interaction between Subunits of Heterodimeric Splicing Factor U2AF Is Essential In Vivo

Interaction between Subunits of Heterodimeric Splicing Factor U2AF Is Essential In Vivo

The Drosophila P-Element KP Repressor Protein Dimerizes and Interacts with Multiple Sites on P-Element DNA

Biochemical Characterization of a Palmitoyl Acyltransferase Activity That Palmitoylates Myristoylated Proteins

Contact Info

Product

Resources

About