5-Fluorocytosine induces fetal skeletal malformations in rats by altering expression of Homeobox genes

Kumamoto, Takayuki; Senuma, Mika; Todoroki, Mai; Kumagai, Fumiaki; Imai, Hiroto; Suzuki, Reiko; Ogawa, Tetsuo; Kuwagata, Makiko

doi:10.2131/fts.7.97

Cited by 3 publications

(2 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The Sox9 forward primer was 5′‐ACAGACTCACATCTCTCCTAATGCT‐3′, and the Sox9 reverse primer was 5′‐CATGTAAGTGAAGGTGGAGTAGAGC‐3′. These primers amplified an 820‐bp DNA sequence 15 . The Hoxa2 forward primer was 5′‐GAAGAGAAGTCACTCTTTGAGCAAG‐3′, and the Hoxa2 reverse primer was 5′‐GTAATTCAGATGCTGTAGGTCGATT‐3′.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Effect of valproic acid on the formation and migration of cranial neural crest cells at the early developmental stages in rat embryos

Suzuki,

Imai

2024

Congenital Anomalies

Self Cite

View full text Add to dashboard Cite

Cranial neural crest cells (NCCs) are critical for craniofacial development. The administration of valproic acid (VPA) to pregnant females causes craniofacial malformations in offspring. However, the in vivo influence of VPA on mammalian cranial NCCs remains unclear. In this study, we aimed to elucidate the developmental stage‐specific effect of VPA on cranial NCCs through the administration of a single dose of VPA to pregnant rat females immediately prior to the formation of the cranial neural crest (NC). We performed whole‐mount immunohistochemistry or in situ hybridization to examine localization changes of gene transcripts associated with the epithelial–mesenchymal transition of the cranial NC (i.e., cranial NCC formation) and cranial NCC migration. The results showed that Hoxa2 mRNA was abnormally detected and Sox9 mRNA expression was decreased in the midbrain–rhombomere (R) 1/2 NC, which forms cranial NCCs that migrate to the frontonasal mass (FNM) and branchial arch (BA) 1, through VPA administration, thus reducing the formation of SNAI2‐positive NCCs. Hoxa2‐positive NCCs were detected normally in BA2 and abnormally in FNM and BA1, which are normally Hox‐free, implying VPA‐induced abnormal cranial NCC migration. In vitro verification experiments using the whole embryo culture system revealed that midbrain–R4 NCC migration was abnormal. These results indicate that VPA reduces the formation/delamination of the midbrain–R1/2 NCCs in a developmental stage‐specific manner and subsequently causes the abnormal migration of R4 NCCs, which suggests that the abnormal formation and migration of cranial NCCs contribute to the inhibition of axonal elongation in the trigeminal nerve and a reduction in head size.

show abstract

Section: Methodsmentioning

confidence: 99%

“…These primers amplified an 820-bp DNA sequence. 15 The Hoxa2 forward primer was 5 0 -GAAGAGAAGTCACTCTTTGAGCAAG-3 0 , and the Hoxa2 reverse primer was 5 0 -GTAATTCAGATGCTGTAGGTCGATT-3 0 . These primers amplified a 447-bp DNA sequence.…”

Section: Whole-mount In Situ Hybridizationmentioning

confidence: 99%

Effect of valproic acid on the formation and migration of cranial neural crest cells at the early developmental stages in rat embryos

Suzuki,

Imai

2024

Congenital Anomalies

Self Cite

View full text Add to dashboard Cite

show abstract

Diverse unintended on-target mutations induced by zygote genome-editing using CRISPR/Cas9 system

Igarashi¹,

Yasuhiko²,

Ono³

et al. 2021

Fundam. Toxicol. Sci.

View full text Add to dashboard Cite

Resistance mechanisms of Cryptococcus spp. and plant compounds as tools to combat them

Silva

Costa

Silva

et al. 2021

RSD

View full text Add to dashboard Cite

Cryptococcus is a genus of dimorphic basidiomycete fungi found in the form of yeasts and filaments. Cryptococcosis has as main etiological agents the species Cryptococcus neoformans and Cryptococcus gattii. This disease is considered a public health problem and has becoming more alarming because of the limitations of antimicrobials available to its treatment, in addition to an increase in reports of fungal resistance. In this sense, the present review sought to survey information on the resistance mechanisms of Cryptococcus spp. against the main drugs used in cryptococcosis therapy as well as on the antimicrobial activities of plants against these fungi. Studies have reported that several mechanisms may be involved in fungal resistance to drugs including drug inactivation by enzymes, expression of efflux pumps and others drug transporters, as well as changes in the drug target and/or implementation of alternative metabolic pathways. As an alternative to conventional antimicrobials, substances and molecules extracted from plants have demonstrated potential for controlling these pathogens. These phytochemicals can trigger the inhibition and/or death of Cryptococcus through morphological changes on fungi cells, inhibition of ergosterol synthesis, cell leakage, capsular decrease, interference in cell division, reduction of activity of several enzymes such as laccase and urease, inhibition of biofilm formation, among others. In this sense, plants are an important source of bioactive compounds with antimicrobial activity that can be studied in the search for new drugs that are increasingly effective, specific and less toxic in the control of cryptococcosis.

show abstract

5-Fluorocytosine induces fetal skeletal malformations in rats by altering expression of Homeobox genes

Cited by 3 publications

References 26 publications

Effect of valproic acid on the formation and migration of cranial neural crest cells at the early developmental stages in rat embryos

Effect of valproic acid on the formation and migration of cranial neural crest cells at the early developmental stages in rat embryos

Diverse unintended on-target mutations induced by zygote genome-editing using CRISPR/Cas9 system

Resistance mechanisms of Cryptococcus spp. and plant compounds as tools to combat them

Contact Info

Product

Resources

About