Untitled

Birch-Machin, Ian; Gao, Shan; Huen, David; McGirr, Richard; White, Robert A.; Russell, Steven

doi:10.1186/gb-2005-6-7-r63

Cited by 76 publications

(52 citation statements)

References 55 publications

(72 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In order to identify the in vivo binding sites of the Drosophila CTCF protein, we used our previously described ChIP-array procedure [39]. Sonicated chromatin, isolated from Drosophila embryos, was immunopurified using either anti-CTCF antiserum (specific immunopurification [IP]) or normal rabbit serum (control IP).…”

Section: Resultsmentioning

confidence: 99%

“…Chromatin from embryos aged between 0 to 20 h after egg laying was purified as described previously [39]. The 300-μl immunopurification reaction contained 1.0 μl of rabbit anti - CTCF antibody for the specific IP or 1 μl of normal rabbit antiserum for the control IP.…”

Section: Methodsmentioning

confidence: 99%

“…The 300-μl immunopurification reaction contained 1.0 μl of rabbit anti - CTCF antibody for the specific IP or 1 μl of normal rabbit antiserum for the control IP. ChIP enrichment was assayed using PCR with specific primers as described previously [39]. The primers used were to Fab-8 (UBX65), catcttccgttcatccgtttc and tgttggtgagcaagcgaaga, and Clone 10, attgggattctgcgattctg and tactgttcctggtgctggtg [13].…”

Section: Methodsmentioning

confidence: 99%

“…Amplification and labelling of DNA from enriched chromatin and hybridisations to genomic DNA tiling arrays were carried out as described previously [39]. We used four biological replicates (i.e., independent chromatin preparations), and each of these was hybridised as dye-swap technical replicates giving 16 array hybridisations in total.…”

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

CTCF Genomic Binding Sites in Drosophila and the Organisation of the Bithorax Complex

et al. 2007

Self Cite

View full text Add to dashboard Cite

Insulator or enhancer-blocking elements are proposed to play an important role in the regulation of transcription by preventing inappropriate enhancer/promoter interaction. The zinc-finger protein CTCF is well studied in vertebrates as an enhancer blocking factor, but Drosophila CTCF has only been characterised recently. To date only one endogenous binding location for CTCF has been identified in the Drosophila genome, the Fab-8 insulator in the Abdominal-B locus in the Bithorax complex (BX-C). We carried out chromatin immunopurification coupled with genomic microarray analysis to identify CTCF binding sites within representative regions of the Drosophila genome, including the 3-Mb Adh region, the BX-C, and the Antennapedia complex. Location of in vivo CTCF binding within these regions enabled us to construct a robust CTCF binding-site consensus sequence. CTCF binding sites identified in the BX-C map precisely to the known insulator elements Mcp, Fab-6, and Fab-8. Other CTCF binding sites correlate with boundaries of regulatory domains allowing us to locate three additional presumptive insulator elements; “Fab-2,” “Fab-3,” and “Fab-4.” With the exception of Fab-7, our data indicate that CTCF is directly associated with all known or predicted insulators in the BX-C, suggesting that the functioning of these insulators involves a common CTCF-dependent mechanism. Comparison of the locations of the CTCF sites with characterised Polycomb target sites and histone modification provides support for the domain model of BX-C regulation.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

CTCF Genomic Binding Sites in Drosophila and the Organisation of the Bithorax Complex

et al. 2007

Self Cite

View full text Add to dashboard Cite

show abstract

“…ChIP was performed as described by Birch-Machin et al (29). One hundred-milliliter aliquots of chromatin were precleared with 13 l blocked Staphylococcus aureus cells (SAC) and mixed with 200 l of IP dilution buffer (16.7 mM Tris-HCl, pH 8, 167 mM NaCl, 1% EDTA, 1.1% Triton X-100, 0.01% SDS) with protease inhibitors.…”

Section: Methodsmentioning

confidence: 99%

A Variably Occupied CTCF Binding Site in the Ultrabithorax Gene in the Drosophila Bithorax Complex

Magbanua

Rünneburger

Russell

et al. 2015

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

Although the majority of genomic binding sites for the insulator protein CCCTC-binding factor (CTCF) are constitutively occupied, a subset show variable occupancy. Such variable sites provide an opportunity to assess context-specific CTCF functions in gene regulation. Here, we have identified a variably occupied CTCF site in the Drosophila Ultrabithorax (Ubx) gene. This site is occupied in tissues where Ubx is active (third thoracic leg imaginal disc) but is not bound in tissues where the Ubx gene is repressed (first thoracic leg imaginal disc). Using chromatin conformation capture, we show that this site preferentially interacts with the Ubx promoter region in the active state. The site lies close to Ubx enhancer elements and is also close to the locations of several gypsy transposon insertions that disrupt Ubx expression, leading to the bx mutant phenotype. gypsy insertions carry the Su(Hw)-dependent gypsy insulator and were found to affect both CTCF binding at the variable site and the chromatin topology. This suggests that insertion of the gypsy insulator in this region interferes with CTCF function and supports a model for the normal function of the variable CTCF site as a chromatin loop facilitator, promoting interaction between Ubx enhancers and the Ubx transcription start site.

show abstract

Genetic variation for tolerance to high temperatures in a population ofDrosophila melanogaster

Rolandi

Lighton²,

Vega

et al. 2018

Ecology and Evolution

View full text Add to dashboard Cite

The range of thermal tolerance is one of the main factors influencing the geographic distribution of species. Climate change projections predict increases in average and extreme temperatures over the coming decades; hence, the ability of living beings to resist these changes will depend on physiological and adaptive responses. On an evolutionary scale, changes will occur as the result of selective pressures on individual heritable differences. In this work, we studied the genetic basis of tolerance to high temperatures in the fly Drosophila melanogaster and whether this species presents sufficient genetic variability to allow expansion of its upper thermo‐tolerance limit. To do so, we used adult flies derived from a natural population belonging to the Drosophila Genetic Reference Panel, for which genomic sequencing data are available. We characterized the phenotypic variation of the upper thermal limit in 34 lines by measuring knockdown temperature (i.e., critical thermal maximum [CTmax]) by exposing flies to a ramp of increasing temperature (0.25°C/min). Fourteen percent of the variation in CTmax is explained by the genetic variation across lines, without a significant sexual dimorphism. Through a genomewide association study, 12 single nucleotide polymorphisms associated with the CTmax were identified. In most of these SNPs, the less frequent allele increased the upper thermal limit suggesting that this population harbors raw genetic variation capable of expanding its heat tolerance. This potential upper thermal tolerance increase has implications under the global warming scenario. Past climatic records show a very low incidence of days above CTmax (10 days over 25 years); however, future climate scenarios predict 243 days with extreme high temperature above CTmax from 2045 to 2070. Thus, in the context of the future climate warming, rising temperatures might drive the evolution of heat tolerance in this population by increasing the frequency of the alleles associated with higher CTmax.

show abstract

Untitled

Cited by 76 publications

References 55 publications

CTCF Genomic Binding Sites in Drosophila and the Organisation of the Bithorax Complex

CTCF Genomic Binding Sites in Drosophila and the Organisation of the Bithorax Complex

A Variably Occupied CTCF Binding Site in the Ultrabithorax Gene in the Drosophila Bithorax Complex

Genetic variation for tolerance to high temperatures in a population ofDrosophila melanogaster

Contact Info

Product

Resources

About