Role of miR‐31 and SATB2 in arsenic‐induced malignant BEAS‐2B cell transformation

Abstract

Arsenic is a naturally occurring and highly potent metalloid known to elicit serious public health concerns. Today, approximately 200 million people around the globe are exposed to arsenic-contaminated drinking water at levels greater than the World Health Organization's recommended limit of 10 parts per billion. As a class I human carcinogen, arsenic exposure is known to elicit various cancers, including lung, skin, liver, and kidney. Current evidence suggests that arsenic is capable of inducing both genotoxic and cytotoxic injury, as well as activating epigenetic pathways to induce carcinogenesis. Our study identifies a novel pathway that is implicated in arsenic-induced carcinogenesis. Arsenic down-regulated miRNA-31 and the release of this inhibition caused overexpression of special AT-rich sequence-binding protein 2 (SATB2). Arsenic is known to disrupt miRNA expression, and here we report for the first time that arsenic is capable of inhibiting miR-31 expression. As a direct downstream target of miR-31, SATB2 is a prominent transcription factor, and nuclear matrix binding protein implicated in many types of human diseases including lung cancer. Results from this study show that arsenic induces the overexpressing SATB2 by inhibiting miR-31 expression, which blocks the translation of SATB2 mRNA, since levels of SATB2 mRNA remain the same but protein levels decrease. Overexpression of SATB2 induces malignant transformation of human bronchial epithelial (BEAS-2B) cells indicating the importance of the expression of miR-31 in preventing carcinogenesis by suppressing SATB2 protein levels.

ICAM5 as a Novel Target for Treating Cognitive Impairment in Fragile X Syndrome

“…Total RNA was extracted by Invitrogen TRIzol Reagent (Thermo Fisher Scientific) and subsequently synthesized into single-strand cDNA using Invitrogen Superscript II reverse transcriptase (Thermo Fisher Scientific). The cDNA amplification was performed using SYBR Premix Ex Tap (Tli RNaseH Plus, Takara) on the Bio-Rad CFX96 system (Chen et al, 2018). Genes and forward/reverse primers used for qRT-PCR are as follows: ␤-actin: forward, CTCTTTTCCAGCCTTCCTTCTTG; reverse, AGAGGTCTT TACGGATGTCAACG; FMR1: forward, ATCGCTAAT GCCACTGTTCTTT; reverse, CGACCCATTCCTTG ACCATC; ICAM5: forward, AGAACAGGAAGGCACCAAACAG; reverse, CTGG CTCACT CAAAGTCAGAAGAG; and U1 snRNA: forward, GGGAGATACCA TGATC ACGAAGGT; reverse, CCACAAATTATGCA GTCGAGTTT CCC.…”

Deregulation of SATB2 in carcinogenesis with emphasis on miRNA-mediated control

“…In stomach, ovarian, prostate and breast cancers, miR-31 is found downregulated, whereas colorectal, liver and head-andneck tumors demonstrate upregulated miR-31 expression (71). Arsenic, a potent environmental carcinogen, has also been found to repress miR-31 expression and subsequently promote the translation of SATB2 protein in human bronchial epithelial (BEAS-2B) cells (52). This study suggests that both upregulation of SATB2 and suppression of miR-31 are correlated with the malignant transformation of BEAS-2B cells.…”

“…In the context of SATB2, it is important to take into consideration both cellular context and degree of miRNA regulation. For example, although miR-31 has been shown to regulate SATB2 in multiple types of cancer tissues including lung, breast and colorectal, miR-211 has only been shown to be deregulated in liver cancer (52)(53)(54)(55). In addition to tissue-dependent miRNA regulation, it is also important to determine the degree of which each miRNA regulates SATB2 expression.…”

Inorganic arsenic‐mediated upregulation of AS3MT promotes proliferation of nonsmall cell lung cancer cells by regulating cell cycle genes

“…Humans are long‐term exposure to arsenic from drinking water and arsenic smelting plants, which poses a major threat to public health 1,2 . Today, about 200 million people in different parts of the world are chronically exposed to potentially toxic levels of arsenic 3 . With the development of industry, agriculture and medicine, occupational exposure to arsenic can occur in a number of work settings including mining and smelting of arsenic‐containing minerals, herbicides, and anticancer drugs 4 .…”

“…1,2 Today, about 200 million people in different parts of the world are chronically exposed to potentially toxic levels of arsenic. 3 With the development of industry, agriculture and medicine, occupational exposure to arsenic can occur in a number of work settings including mining and smelting of arsenic-containing minerals, herbicides, and anticancer drugs. 4 In China, lung cancer and skin cancer caused by occupational exposure to arsenic and its compounds have been classified as an occupational disease.…”