Pro- versus Antinociceptive Nongenomic Effects of Neuronal Mineralocorticoid versus Glucocorticoid Receptors during Rat Hind Paw Inflammation

Abstract

Background In naive rats, corticosteroids activate neuronal membrane–bound glucocorticoid and mineralocorticoid receptors in spinal cord and periphery to modulate nociceptive behavior by nongenomic mechanisms. Here we investigated inflammation-induced changes in neuronal versus glial glucocorticoid and mineralocorticoid receptors and their ligand-mediated nongenomic impact on mechanical nociception in rats. Methods In Wistar rats (n = 5 to 7/group) with Freund’s complete adjuvant hind paw inflammation, we examined glucocorticoid and mineralocorticoid receptor expression in spinal cord and peripheral sensory neurons versus glial using quantitative reverse transcription-polymerase chain reaction (qRT-PCR), Western blot, immunohistochemistry, and radioligand binding. Moreover, we explored the expression of mineralocorticoid receptors protecting enzyme 11-betahydroxysteroid dehydrogenase type 2 as well as the nociceptive behavioral changes after glucocorticoid and mineralocorticoid receptors agonist or antagonist application. Results Hind paw inflammation resulted in significant upregulation of glucocorticoid receptors in nociceptive neurons of spinal cord (60%) and dorsal root ganglia (15%) as well as mineralocorticoid receptors, while corticosteroid plasma concentrations remained unchanged. Mineralocorticoid (83 ± 16 fmol/mg) but not glucocorticoid (104 ± 20 fmol/mg) membrane binding sites increased twofold in dorsal root ganglia concomitant with upregulated 11-betahydroxysteroid dehydrogenase type 2 (43%). Glucocorticoid and mineralocorticoid receptor expression in spinal microglia and astrocytes was small. Importantly, glucocorticoid receptor agonist dexamethasone or mineralocorticoid receptor antagonist canrenoate-K rapidly and dose-dependently attenuated nociceptive behavior. Isobolographic analysis of the combination of both drugs showed subadditive but not synergistic or additive effects. Conclusions The enhanced mechanical sensitivity of inflamed hind paws accompanied with corticosteroid receptor upregulation in spinal and peripheral sensory neurons was attenuated immediately after glucocorticoid receptor agonist and mineralocorticoid receptor antagonist administration, suggesting acute nongenomic effects consistent with detected membrane-bound corticosteroid receptors.

Aldosterone Synthase in Peripheral Sensory Neurons Contributes to Mechanical Hypersensitivity during Local Inflammation in Rats

“…Freund's complete adjuvant, a water-in-oil emulsion with killed mycobacteria (Calbiochem, USA); canrenoate-K, and aldosterone synthase inhibitor (FAD286; Sigma-Aldrich, USA) were dissolved in 0.9% NaCl as described previously. 18,19 Drugs were administered subcutaneously in a volume of 1 ml/kg body weight or intrathecally in a volume of 20 µl. Subcutaneous injections were given under the loose skin of the back, just behind and between the shoulder blades.…”

“…The doses chosen for canrenoate-K were based on our previous studies. 19,22 A final set of experiments investigated at 4 days of Freund's complete adjuvant hind paw inflammation the effects of the intrathecal delivery of the aldosterone synthase inhibitor, FAD286, on both aldosterone content and on mechanical paw pressure thresholds. Rats received the following intrathecal treatments for more than 5 days, beginning 1 day before Freund's complete adjuvant-induced inflammation.…”

“…The mechanical hyperalgesia following Freund's complete adjuvant-induced hind paw inflammation was assessed by a pressure apparatus (Ugo-Basile SRL, Italy) with increasing force (measured in grams) applied to the plantar hind paw until a withdrawal reflex was precipitated as described previously. 19 A 250-g cut-off value was assigned in the absence of a response. Mechanical paw pressure tests were performed on the fourth day of Freund's complete adjuvant-induced hind paw inflammation before (baseline) and after drug application.…”

“…Total RNA extracted from L3-L5 dorsal root ganglia of Wistar rats using RNeasy Kit (Qiagen, Germany), as previously described, 19,24 was subjected to the TaqMan quantitative polymerase chain reaction using an SYBR Green kit following the manufacturer's instructions (Thermo Fisher Scientific, Germany). The products were amplified using aldosterone synthase CYP11B2 specific primers: forward primer, 5'-TGGCAGCACTAATAACTCAGGG-3'; reverse primer, 5'-ATTGCTGTCGTGTCAACGCT-3' (Ensemble, Accession No: NM_012538.2); for 11β-hydroxysteroid-dehydrogenase: forward primer, 5'-CGCCGC TTCCTACAGAACTT-3'; reverse primer, 5'-TCCTGGGTTGTGTCATGAACA-3'…”

“…Aldosterone synthase and 11βhydroxysteroid-dehydrogenase mRNA products were quantified in replicates of three samples using the delta-delta Ct method. 19 In addition, the housekeeping gene 18s (Accession No. NR_046237) as the internal reference was quantified using TaqMan quantitative polymerase chain reaction with the following primers: forward primer, CGGCTACCACATCCAAGGAA; reverse primer, GCTGGAATTACCGCGGCT.…”