Mechanism of Neuroprotection Against Experimental Spinal Cord Injury by Riluzole or Methylprednisolone

Abstract

Any spinal cord injury carries the potential for persistent disability affecting motor, sensory and autonomic functions. To prevent this outcome, it is highly desirable to block a chain of deleterious reactions developing in the spinal areas immediately around the primary lesion. Thus, early timing of pharmacological neuroprotection should be one major strategy whose impact may be first studied with preclinical models. Using a simple in vitro model of the rat spinal cord it is possible to mimic pathological processes like excitotoxicity that damages neurons because of excessive glutamate receptor activation due to injury, or hypoxic/dysmetabolic insult that preferentially affects glia following vascular dysfunction. While ongoing research is exploring the various components of pathways leading to cell death, current treatment principally relies on the off-label use of riluzole (RLZ) or methylprednisolone sodium succinate (MPSS). The mechanism of action of these drugs is diverse as RLZ targets mainly neurons and MPSS targets glia. Even when applied after a transient excitotoxic stimulus, RLZ can provide effective prevention of secondary excitotoxic damage to premotoneurons, although not to motoneurons that remain very vulnerable. This observation indicates persistent inability to express locomotor activity despite pharmacological treatment conferring some histological protection. MPSS can protect glia from dysmetabolic insult, yet it remains poorly effective to prevent neuronal death. In summary, it appears that these pharmacological agents can produce delayed protection for certain cell types only, and that their combined administration does not provide additional benefit. The search should continue for better, mechanism-based neuroprotective agents.

Repurposing Potential of Riluzole as an ITAF Inhibitor in mTOR Therapy Resistant Glioblastoma

“…Riluzole is an FDA-approved drug for the treatment of amyotrophic lateral sclerosis (ALS) and several off-label indications for psychiatric and neurologic disorders have been described [29][30][31][32]. Interestingly, pathogenic mutations of hnRNP A1 have been linked to inclusion body formation in ALS [33] and the discovery that riluzole interacts with hnRNP A1 suggests a mechanism for action for this drug in ALS which has thus far been lacking.…”

Riluzole promotes neurological function recovery and inhibits damage extension in rats following spinal cord injury: a meta‐analysis and systematic review

“…; Vasconcelos et al . ), which may relate to a reduction in intracellular sodium accumulation and calcium overload (Urbani and Belluzzi ; Sámano and Nistri ). The activation of endoplasmic reticulum stress signals, c‐Jun N‐terminal kinase (JNK) and the family of caspase proteins are strongly linked to cell death, while riluzole can modulate the activation of JNK, caspase‐3, and Bcl‐2 (Hassanzadeh et al .…”

“…Following CNS injury, the activation of neuronal VGSCs causes a marked increase in intracellular sodium, with a resulting accumulation of calcium and an activation of neurotoxic signaling cascades (He et al 2017). Riluzole was previously reported to reduce neural cell death and preserve spinal cord white matter injury (Hosier et al 2015;Vasconcelos et al 2016), which may relate to a reduction in intracellular sodium accumulation and calcium overload (Urbani and Belluzzi 2000;S amano and Nistri 2017). The activation of endoplasmic reticulum stress signals, c-Jun Nterminal kinase (JNK) and the family of caspase proteins are strongly linked to cell death, while riluzole can modulate the activation of JNK, caspase-3, and Bcl-2 (Hassanzadeh et al 2010;Hemendinger et al 2012;Roth et al 2012).…”

MANF attenuates neuronal apoptosis and promotes behavioral recovery via Akt/MDM‐2/p53 pathway after traumatic spinal cord injury in rats

“…Data was normalized according to the internal control gene and then normalized against the sham group to acquire the relative levels. The primer sequences were as follows: p53: 5′‐CCCAGGGAGTGCAAAGAGAG‐3′ (forward) and 5′‐TCTCGGAACATCTCGAAGCG‐3′ (reverse); β‐actin: 5′‐CAC TGCCGCATCCTCTTCCT‐3′ (forward) and 5′‐AACCGCTCATTG CCGATAGTG‐3′ (reverse).…”

“…The pathology of t‐SCI arises as a result of both primary injury and the secondary injury. The term primary injury refers to a direct, traumatic attack to the spinal cord that causes structural damage, including cell death, local axonotmesis, and blood vessels rupture with focal hemorrhage around the injury site . Secondary injury is caused by diverse molecular, cellular, and biochemical responses induced by the primary injury.…”