First evidence of resistance to pyrethroid insecticides in ItalianAedes albopictuspopulations 26 years after invasion

Abstract

This study reports the first evidence of resistance to pyrethroids in adult Italian Ae. albopictus populations. Results refer to the season preceding the Chikungunya 2017 outbreak in central Italy and highlight the need to increase efforts to monitor the spread of insecticide resistance and the need to develop strategies to limit the spread of insecticide resistance, particularly in areas where extensive treatments have been carried out to contain disease outbreaks. © 2017 Society of Chemical Industry.

Phenotypic and genotypic pyrethroid resistance ofAedes albopictus, with focus on the 2017 chikungunya outbreak in Italy

“…). As in Pichler et al , collections at each sampling site were carried out with five or more ovitraps to avoid oversampling of siblings, and egg samples on germination paper were sealed in plastic bags and sent by express courier to the Department of Public Health and Infectious Diseases (DPHID) at Sapienza University in Rome.…”

“…Bioassays were performed, as already described in Pichler et al , at DPHID following test procedures using WHO test‐tubes lined with filter papers impregnated with one of the following insecticides: permethrin (concentration = 0.75%), α‐cypermethrin (0.05%), deltamethrin (0.05%) (Vector Control Research Unit, School of Biological Sciences, 11800 Minden, Penang, Malaysia). Insecticide concentrations were higher than the tentative concentrations proposed by WHO guidelines for Aedes mosquitoes (i.e.…”

“…Since we could not afford to test all populations for all three pyrethroids, only mosquitoes exposed to permethrin, either in the present or in previous studies (Pichler et al 38; Kasai et al in press), were included in this analysis to be able to compare results with field data by Kasai et al (in press). Genotyping was performed on samples collected from nine Italian regions, one site in Albania and one site in Greece (sampled either in the present study or in Pichler et al ; Table ), following the PCR protocol described by Kasai et al , with successive modifications (Kasai et al in press). Briefly, the primers used were aegSCF20: GACAATGTGGATCGCTTCCC and aegSCR21: GCAATCTGGCTTGTTAACTTG; PCR reaction was performed in a 25 μL volume containing 10x reaction Buffer, 0.2 μ m of each primer, 0.1 m m of each dNTP, 3 m m of MgCl2, 1 U of TaqPolymerase (BIOTAQ™ Bioline) and 1 μL of DNA extracted from a whole mosquito.…”

“…The few studies conducted on PR in Ae. albopictus from temperate areas have mostly reported full susceptibility, while first evidence of resistance to one or the other compound was recently observed in Spain, Italy and the USA …”

“…Indeed, it is likely that PR is more widespread than presently revealed by the few pyrethroid‐resistant Ae. albopictus populations detected so far in Europe . In fact, populations in temperate regions have been subjected in the past to selective pressure due to the patchy and uncontrolled, yet not neglectable, use of insecticide‐based space spraying by private citizens and public administrations to achieve immediate and tangible, even though short‐term, effects on mosquito nuisance …”