A novel role of Krüppel-like factor 4 in Zhikong scallop Chlamys farreri during spermatogenesis

Abstract

Krüppel-like factor 4 (KLF4) is a kind of zinc finger transcription factor, which is involved in terminal differentiation of epithelial cells and reprogramming of somatic cells to induced pluripotent stem (iPS) cells in mammals. In the present study, we identified a full-length cDNA of Klf4 in Zhikong scallop Chamys farreri (Cf-Klf4) and found that Cf-Klf4 presented a sexual dimorphic expression characteristic in C. farreri gonads. Cf-Klf4 expression was significantly higher in testes than in ovaries from growing stage to mature stage detected by quantitative real-time PCR, and was located in male gametes, except for spermatozoa during spermatogenesis through in situ hybridization and immunohistochemistry, while no positive signal was visible in female gametes during oogenesis. Furthermore, the knockdown of Cf-Klf4 in testes by means of in vivo RNA interference led to an obviously developmental retardance, lower gonadosomatic index, less male gametes and more apoptotic spermatocytes. Interestingly, we found that two out of eight scallops showed a hermaphroditic phenotype characteristic of male-to-female sex reversal when the Klf4 mRNA and protein levels were knocked down in males. These results verified that Klf4 plays an important role in testis functional maintenance and is necessary in spermatogenesis of C. farreri.

Molecular Cloning and Sexually Dimorphic Expression Analysis of nanos2 in the Sea Urchin, Mesocentrotus nudus

“…RNA interference (RNAi), however, provides an alternative approach because of the direct injection of plasmids or RNAs. Moreover, compared to mammals, the effects of RNAi last much longer and it has been used in non-model invertebrate species, such as sea cucumber ( Apostichopus japonicus ) [21], Zhikong scallop ( Chlamys farreri ) [22], and Giant Freshwater Prawn ( Macrobrachium rosenbergii ) [23].…”

Successful Transplantation of Spermatogonial Stem Cells Into the Seminiferous Tubules of Busulfan-treated Mice

“…In mammals, a zinc nger transcription factor, known as kruppel-like factor 4 (KLF4), plays an important role in reprogramming of somatic cells to induced pluripotent stem cells. KLF4 has been reported to regulate early spermatogenesis and maintain the functions of testis [28].…”

SOX2 participates in spermatogenesis of Zhikong scallop Chlamys farreri

“…Previous study of KLF4 gene in C . farreri indicated that Cf-KLF4 regulates early spermatogenesis, and promotes the differentiation of spermatogonia and spermatocyte, as well as the apoptosis of spermatocytes 23 . And our further transcriptomic study after Cf-KLF4 was knockdown showed that several genes exhibited similar expression patterns ( IAPs , TNFR , TRAF etc.)…”

“…69 and Yang et al . 23 with some modifications. Two specific primers, RNAi-F: 5′- TAATACGACTCACTATAGGGAG AGGACAAATACGCTCTACCAGG-3′ (T7 promoter underlined) and RNAi-R: 5′- TAATACGACTCACTATAGGGAG CATATGAGTAAGCGGAACAG-3′ (T7 promoter underlined) were designed according to Cf-SOX2 cDNA sequence to amplify a fragment of 506 bp.…”

“…were screened out through pyrosequencing in giant lion’s paw Nodipecten subnodosus 19 . In Zhikong scallop Chlamys farreri , multiple genes have been cloned and proposed playing roles in gametogenesis based on their expression pattern ( DAX1 , β-Catenin and FOXL2 ) 20–22 , while recently KLF4 and PIWI1 genes were validated involving in spermatogenesis and gametogenesis, respectively, through RNAi 23,24 . Besides, function of many sox family genes in gametogenesis have been identified and studied, such as SOX2 , SOX7 , SOX 8 , SOX 14 in pacific oyster Crassostrea gigas 25 ; SOX9 in pearl oyster Pinctada margaritifera 26 ; SOXE , SOXH in Yesso scallop Patinopecten yessoensis 27 ; SOX2 and SOXB2 in C .…”