Rapid Engineering of Foot-and-Mouth Disease Vaccine and Challenge Viruses

Abstract

There are seven antigenically distinct serotypes of foot-and-mouth disease virus (FMDV), each of which has intratypic variants. In the present study, we have developed methods to efficiently generate promising vaccines against seven serotypes or subtypes. The capsid-encoding gene (P1) of the vaccine strain O1/Manisa/Turkey/69 was replaced with the amplified or synthetic genes from the O, A, Asia1, C, SAT1, SAT2, and SAT3 serotypes. Viruses of the seven serotype were rescued successfully. Each chimeric FMDV with a replacement of P1 showed serotype-specific antigenicity and varied in terms of pathogenesis in pigs and mice. Vaccination of pigs with an experimental trivalent vaccine containing the inactivated recombinants based on the main serotypes O, A, and Asia1 effectively protected them from virus challenge. This technology could be a potential strategy for a customized vaccine with challenge tools to protect against epizootic disease caused by specific serotypes or subtypes of FMDV.IMPORTANCE Foot-and-mouth disease (FMD) virus (FMDV) causes significant economic losses. For vaccine preparation, the selection of vaccine strains was complicated by high antigenic variation. In the present study, we suggested an effective strategy to rapidly prepare and evaluate mass-produced customized vaccines against epidemic strains. The P1 gene encoding the structural proteins of the well-known vaccine virus was replaced by the synthetic or amplified genes of viruses of seven representative serotypes. These chimeric viruses generally replicated readily in cell culture and had a particle size similar to that of the original vaccine strain. Their antigenicity mirrored that of the original serotype from which their P1 gene was derived. Animal infection experiments revealed that the recombinants varied in terms of pathogenicity. This strategy will be a useful tool for rapidly generating customized FMD vaccines or challenge viruses for all serotypes, especially for FMD-free countries, which have prohibited the import of FMDVs.

Advanced Foot-And-Mouth Disease Vaccine Platform for Stimulation of Simultaneous Cellular and Humoral Immune Responses

“…Immunopotent FMD vaccine strains were developed by reverse genetics using the P1 backbone of the previously developed A22-R (A22 P1 replacement in the O1 Manisa infectious cDNA) strain [ 10 , 16 ].…”

“…The recombinant plasmid was prepared as described by Lee et al [ 10 ]. The whole FMD-O1 Manisa virus genome (GenBank Accession No.…”

“…With the plasmids prepared as described above (pOm-A22-P1), the universal T cell epitope 3A sequence (GCAGCAATTGAATTCTTTGAGGGAATGGTGCATGACTCCATCAAG), which corresponds to the amino acid residue sequence (AAIEFFEGMVHDSIK), was inserted between the 453 and 454 base pair position (the 151 and 152 amino acid position) of the VP1 sequence. Then, 300 ng/μL of pOm-A22-P1 as PCR template, 1 μL of 10 pmole/μL primer 3A F (5′-GGAATGGTGCATGACTCCATCAAGGCGAGGGTCGCCGCTCAGCT-3′), and 1 μL of 10 pmole/μL primer 3A R (5′-CTCAAAGAATTCAATTGCTGCCGCGAGAGGCCCTAGGTCGC-3′) were used for the preparation of target plasmid by the same self-ligating method used in the previous study [ 10 ]. Figure 1 A represents the schematic diagram of the final plasmid for A-3A.…”

“…Purified antigen was prepared in BHK-21 cells infected with recombinant immunopotent FMDV A-3A and A-HSP70 constructed for the swift phenotype of P1 (referred sequence) by reverse genetics according to the method described by Lee et al, with modifications [ 10 , 11 ]. For viral infection, the culture medium was replaced with serum-free Dulbecco’s modified Eagle’s medium (DMEM; HyClone, Logan, UT, USA) and the cells were inoculated with the virus by incubating for 1 h at 37 °C in a 5% CO 2 atmosphere.…”

New foot-and-mouth disease vaccine, O JC-R, induce complete protection to pigs against SEA topotype viruses occurred in South Korea, 2014–2015

“…In order to secure the FMDVs from the infectious clone, experiments were conducted using a previously described experimental method[12].…”