Molecular identification and functional analysis of Ctrp9 in Epinephelus coioides

Abstract

CTRP9 is a member of the C1q/TNF-related protein (CTRP) superfamily and has been studied in mammals, whereas the comparative studies of CTRP9 in non-mammalian species are still absent. In this study, was isolated and characterized from the orange-spotted grouper (). The full-length cDNA of was 1378 bp in size with an ORF (open reading frame) of 1020 bp that encodes a 339 amino acid pre-pro hormone. The mRNA expression of showed a rather high level in the kidney and brain, but a low level in other tissues. Furthermore, the mRNA expression of decreased significantly in the liver after fasting for 7 days and restored to the normal levels after refeeding. In contrast, the mRNA level increased in the hypothalamus after fasting. The recombinant gCtrp9 (globular Ctrp9) was prepared using the expression system and was verified by Western blot as well as mass spectrometry assays. In the primary hepatocytes culture, the recombinant gCtrp9 could inhibit the glucose production after 12-h treatment. After i.p. (intraperitoneal) injection with recombinant gCtrp9, in hypothalamus, mRNA expression levels of and (orexigenic factors) decreased, whereas the expression levels of and (anorexigenic factors) increased. Moreover, i.p. injection with the recombinant gCtrp9 could reduce the serum concentrations of glucose, TG and low-density lipoprotein cholesterol but increase the content of high-density lipoprotein cholesterol. Our studies for the first time unveil the structure of Ctrp9 and its potential role as a regulatory factor of metabolism and food intake in teleost.

C1q/TNF‐related protein 9: A novel therapeutic target in ischemic stroke?

“…Similarly, mouse CTRP9 and human CTRP9 share 84% amino acid identity as well. CTRP9 mainly expresses in adipose tissue, adipocytes and adipose stromal cells and is detectable in variety of tissues and organs, such as skeletal muscle, brain, liver, and kidney (Li, Zhu et al, ; Yang et al, ). It is noteworthy that only human and primates (chimpanzee and rhesus macaque) possess the CTRP9B so far, even though at extremely low expression levels (Peterson et al, ).…”

CTRP9 ameliorates cellular senescence via PGC‑1α/AMPK signaling in mesenchymal stem cells

“…The results of the current study indicated that MSC proliferation and viability, immune modulation, and angiogenesis-related paracrine ability were all impaired in MSCs from aged donors. CTRP9 is a novel adipokine exclusively expressed in adipocytes and also highly expressed in the brain (10). CTRP9 has been suggested to act as a regulator of vascular function, and to exert protective effects in ischemic diseases (12).…”

“…AmongC1q and tumor necrosis factor-related protein (CTRP) family members, CTRP9 displays the highest amino acid identity to APN. CRTP9 is also highly expressed in brain tissue (10), and acts as an adipocytokine with beneficial effects on glucose metabolism, cellular survival, oxidant response regulation, and inhibition of endoplasmic reticulum stress, all of which are related to the cellular senescence process (11)(12)(13). However, the effect of exogenous CTRP9 on cellular senescence in MSCs, which adversely affects the function of engrafted stem cells, has never been studied.…”

Recombinant expression and comparative bioactivity of tongue sole insulin-like growth factor (IGF)-1 and IGF-2 in Pichia pastoris

“…and , respectively,) from the tongue sole. Recombinant tongue sole IGF‐1 and IGF‐2 proteins were obtained from P. pastoris as described previously (Li et al., ; Yang et al., ) with some modifications. Briefly, the cDNA fragments encoding tongue sole mature IGF‐2 were cloned by PCR with specific primers (Forward primer P1: 5′ CTCGAGAAAAGAGAGGCTGAAGCTGA AATGGCCT 3′; Reverse primer P2: 5′ TCTAGACTAATGATGATGATGATGATGCGTGGAC TTGGG 3′).…”

“…As for the existing expression systems, the protein expressed from a prokaryotic system is always an insoluble inclusion body and requires denaturation and renaturation before it has active bioactivity, which is inefficient and uneconomical for large‐scale production (Sahdev, Khattar, & Saini, ). In recent years, the production of recombinant proteins has increasingly focused on yeast (Chen et al., ; Li et al., ; Sanchis‐Benlloch et al., ; Yang et al., ). Pichia pastoris ( P. pastoris ) is a methylotrophic yeast belonging to the Ascomycetes group.…”